Incidental Mutation 'R7063:Idh2'
ID548392
Institutional Source Beutler Lab
Gene Symbol Idh2
Ensembl Gene ENSMUSG00000030541
Gene Nameisocitrate dehydrogenase 2 (NADP+), mitochondrial
SynonymsIdh-2, IDPm
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7063 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location80094846-80115392 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80095684 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 403 (V403A)
Ref Sequence ENSEMBL: ENSMUSP00000103007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049680] [ENSMUST00000107384] [ENSMUST00000125542] [ENSMUST00000134328] [ENSMUST00000164056] [ENSMUST00000166250] [ENSMUST00000206714]
Predicted Effect probably benign
Transcript: ENSMUST00000049680
SMART Domains Protein: ENSMUSP00000050577
Gene: ENSMUSG00000048897

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
low complexity region 76 88 N/A INTRINSIC
low complexity region 106 127 N/A INTRINSIC
low complexity region 169 181 N/A INTRINSIC
low complexity region 187 201 N/A INTRINSIC
ZnF_C2H2 297 319 2.71e-2 SMART
ZnF_C2H2 325 347 1.92e-2 SMART
ZnF_C2H2 353 375 2.71e-2 SMART
ZnF_C2H2 381 403 1.18e-2 SMART
ZnF_C2H2 409 431 1.67e-2 SMART
ZnF_C2H2 437 459 4.87e-4 SMART
ZnF_C2H2 465 487 3.83e-2 SMART
ZnF_C2H2 493 515 2.12e-4 SMART
ZnF_C2H2 521 543 3.63e-3 SMART
ZnF_C2H2 549 571 1.58e-3 SMART
ZnF_C2H2 577 600 3.69e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107384
AA Change: V403A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103007
Gene: ENSMUSG00000030541
AA Change: V403A

DomainStartEndE-ValueType
Iso_dh 49 441 5.32e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125542
Predicted Effect probably benign
Transcript: ENSMUST00000134328
SMART Domains Protein: ENSMUSP00000118184
Gene: ENSMUSG00000030541

DomainStartEndE-ValueType
Iso_dh 49 284 1.59e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164056
SMART Domains Protein: ENSMUSP00000132361
Gene: ENSMUSG00000048897

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
low complexity region 76 88 N/A INTRINSIC
low complexity region 106 127 N/A INTRINSIC
low complexity region 169 181 N/A INTRINSIC
low complexity region 187 201 N/A INTRINSIC
ZnF_C2H2 297 319 2.71e-2 SMART
ZnF_C2H2 325 347 1.92e-2 SMART
ZnF_C2H2 353 375 2.71e-2 SMART
ZnF_C2H2 381 403 1.18e-2 SMART
ZnF_C2H2 409 431 1.67e-2 SMART
ZnF_C2H2 437 459 4.87e-4 SMART
ZnF_C2H2 465 487 3.83e-2 SMART
ZnF_C2H2 493 515 2.12e-4 SMART
ZnF_C2H2 521 543 3.63e-3 SMART
ZnF_C2H2 549 571 1.58e-3 SMART
ZnF_C2H2 577 600 3.69e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166250
SMART Domains Protein: ENSMUSP00000129357
Gene: ENSMUSG00000048897

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
low complexity region 76 88 N/A INTRINSIC
low complexity region 106 127 N/A INTRINSIC
low complexity region 169 181 N/A INTRINSIC
low complexity region 187 201 N/A INTRINSIC
ZnF_C2H2 297 319 2.71e-2 SMART
ZnF_C2H2 325 347 1.92e-2 SMART
ZnF_C2H2 353 375 2.71e-2 SMART
ZnF_C2H2 381 403 1.18e-2 SMART
ZnF_C2H2 409 431 1.67e-2 SMART
ZnF_C2H2 437 459 4.87e-4 SMART
ZnF_C2H2 465 487 3.83e-2 SMART
ZnF_C2H2 493 515 2.12e-4 SMART
ZnF_C2H2 521 543 3.63e-3 SMART
ZnF_C2H2 549 571 1.58e-3 SMART
ZnF_C2H2 577 600 3.69e-4 SMART
low complexity region 614 633 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206714
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. Each NADP(+)-dependent isozyme is a homodimer. The protein encoded by this gene is the NADP(+)-dependent isocitrate dehydrogenase found in the mitochondria. It plays a role in intermediary metabolism and energy production. This protein may tightly associate or interact with the pyruvate dehydrogenase complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit suppression of tumorigenesis from B16F10 melanoma cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap35 A G 7: 16,565,113 V9A probably benign Het
Btbd6 A G 12: 112,977,512 Y148C probably damaging Het
C130060K24Rik A G 6: 65,441,403 probably benign Het
Casr T C 16: 36,494,574 I968V probably benign Het
Celf1 T C 2: 91,012,844 probably null Het
Chst2 G T 9: 95,405,568 R242S probably benign Het
Clca3a1 T A 3: 144,755,206 D228V probably damaging Het
Cwf19l2 A G 9: 3,430,532 Y288C probably benign Het
Cyp2r1 A G 7: 114,552,949 S49P probably damaging Het
Dnah5 A G 15: 28,233,248 E251G probably benign Het
Eepd1 A G 9: 25,483,036 R199G possibly damaging Het
Fat1 C T 8: 45,040,775 T3986I probably benign Het
Gbp4 G A 5: 105,118,448 R576C probably damaging Het
Glp1r A G 17: 30,925,558 Y235C probably damaging Het
Gm31371 G A 8: 19,903,412 C7Y Het
Gm6408 T C 5: 146,483,784 I158T probably benign Het
Gpr89 C G 3: 96,875,698 R312P probably damaging Het
Lclat1 A G 17: 73,239,991 E301G possibly damaging Het
Lgmn A G 12: 102,402,678 Y181H probably damaging Het
Lgr5 T C 10: 115,456,734 Y417C probably damaging Het
Man1a G T 10: 54,030,744 N311K probably damaging Het
Nat10 G A 2: 103,748,077 L228F probably benign Het
Olfr1417 A G 19: 11,828,184 F281L probably damaging Het
Olfr1445 A G 19: 12,884,085 D68G probably damaging Het
Olfr476 C A 7: 107,968,204 A269E probably benign Het
Olfr958 T G 9: 39,550,115 Y252S possibly damaging Het
Pcmtd2 T A 2: 181,854,983 Y130* probably null Het
Rapgef5 A G 12: 117,689,129 D62G possibly damaging Het
Serpina3m A T 12: 104,391,467 I217L probably benign Het
Supt16 T C 14: 52,172,048 R802G possibly damaging Het
Sypl2 A T 3: 108,217,655 M130K probably benign Het
Tmtc2 A T 10: 105,348,525 L503Q probably damaging Het
Ubald2 A G 11: 116,434,617 Q60R probably benign Het
Vav1 C T 17: 57,311,860 Q673* probably null Het
Vgll2 T C 10: 52,027,976 S312P probably benign Het
Vmn1r191 C T 13: 22,178,694 A297T probably benign Het
Vmn1r7 T A 6: 57,024,433 I281F possibly damaging Het
Vmn2r108 T C 17: 20,481,148 Y30C probably damaging Het
Vmn2r16 A G 5: 109,363,784 N619S probably damaging Het
Vstm5 A G 9: 15,239,253 probably benign Het
Zfp7 A G 15: 76,891,719 I654V possibly damaging Het
Zmat2 A G 18: 36,796,574 N129S probably null Het
Other mutations in Idh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01529:Idh2 APN 7 80097945 missense probably benign
IGL02281:Idh2 APN 7 80095802 splice site probably null
IGL02874:Idh2 APN 7 80097873 missense probably damaging 1.00
IGL02892:Idh2 APN 7 80095670 missense probably benign
IGL02937:Idh2 APN 7 80098913 missense probably damaging 1.00
IGL02989:Idh2 APN 7 80099108 missense probably damaging 1.00
R0040:Idh2 UTSW 7 80097822 missense probably damaging 1.00
R0040:Idh2 UTSW 7 80097822 missense probably damaging 1.00
R0090:Idh2 UTSW 7 80097914 missense probably damaging 1.00
R0322:Idh2 UTSW 7 80098257 missense probably damaging 1.00
R0384:Idh2 UTSW 7 80098257 missense probably damaging 1.00
R0385:Idh2 UTSW 7 80098257 missense probably damaging 1.00
R0386:Idh2 UTSW 7 80098257 missense probably damaging 1.00
R0387:Idh2 UTSW 7 80098257 missense probably damaging 1.00
R0494:Idh2 UTSW 7 80098257 missense probably damaging 1.00
R1603:Idh2 UTSW 7 80099158 missense probably damaging 1.00
R1681:Idh2 UTSW 7 80099158 missense probably damaging 1.00
R1711:Idh2 UTSW 7 80099158 missense probably damaging 1.00
R1844:Idh2 UTSW 7 80098877 missense probably benign 0.31
R3700:Idh2 UTSW 7 80099147 missense probably damaging 1.00
R4941:Idh2 UTSW 7 80096099 missense probably damaging 0.98
R5234:Idh2 UTSW 7 80096105 missense probably damaging 0.99
R5387:Idh2 UTSW 7 80098331 intron probably benign
R5582:Idh2 UTSW 7 80098339 frame shift probably null
R5655:Idh2 UTSW 7 80098248 missense probably damaging 0.99
R6191:Idh2 UTSW 7 80098331 intron probably benign
R6261:Idh2 UTSW 7 80098329 intron probably benign
R6311:Idh2 UTSW 7 80098331 intron probably benign
R6351:Idh2 UTSW 7 80098331 intron probably benign
R6413:Idh2 UTSW 7 80098331 intron probably benign
R6561:Idh2 UTSW 7 80098331 intron probably benign
R6709:Idh2 UTSW 7 80098331 intron probably benign
R6772:Idh2 UTSW 7 80098331 intron probably benign
R6781:Idh2 UTSW 7 80098331 intron probably benign
R6848:Idh2 UTSW 7 80098331 intron probably benign
R6861:Idh2 UTSW 7 80098218 missense probably damaging 1.00
R6899:Idh2 UTSW 7 80098331 intron probably benign
R7076:Idh2 UTSW 7 80098331 intron probably benign
R7081:Idh2 UTSW 7 80098329 intron probably benign
R7090:Idh2 UTSW 7 80098331 intron probably benign
R7254:Idh2 UTSW 7 80098331 frame shift probably null
R7298:Idh2 UTSW 7 80098331 intron probably benign
R7401:Idh2 UTSW 7 80098329 intron probably benign
R7560:Idh2 UTSW 7 80098331 frame shift probably null
R7561:Idh2 UTSW 7 80098331 intron probably benign
R7694:Idh2 UTSW 7 80098331 intron probably benign
R7816:Idh2 UTSW 7 80098331 intron probably benign
R7884:Idh2 UTSW 7 80098329 intron probably benign
R7919:Idh2 UTSW 7 80098331 intron probably benign
R7961:Idh2 UTSW 7 80098253 missense probably benign 0.18
R8009:Idh2 UTSW 7 80098253 missense probably benign 0.18
R8036:Idh2 UTSW 7 80098331 intron probably benign
R8162:Idh2 UTSW 7 80098329 intron probably benign
R8321:Idh2 UTSW 7 80098331 intron probably benign
R8451:Idh2 UTSW 7 80098331 intron probably benign
R8488:Idh2 UTSW 7 80098329 intron probably benign
R8501:Idh2 UTSW 7 80098331 intron probably benign
R8671:Idh2 UTSW 7 80098331 intron probably benign
R8673:Idh2 UTSW 7 80098331 intron probably benign
R8707:Idh2 UTSW 7 80098329 intron probably benign
R8725:Idh2 UTSW 7 80098331 frame shift probably null
R8863:Idh2 UTSW 7 80098331 intron probably benign
R8872:Idh2 UTSW 7 80098331 intron probably benign
R8892:Idh2 UTSW 7 80098331 intron probably benign
R8915:Idh2 UTSW 7 80098331 intron probably benign
RF030:Idh2 UTSW 7 80098329 intron probably benign
Predicted Primers PCR Primer
(F):5'- AGCCATTTCTCAGGACTTGTC -3'
(R):5'- GTACCAACCCTATTGCCAGC -3'

Sequencing Primer
(F):5'- GACTTGTCCTGCCCCAGAC -3'
(R):5'- GCATCTTTGCCTGGACACG -3'
Posted On2019-05-13