Incidental Mutation 'R7063:Cyp2r1'
ID548394
Institutional Source Beutler Lab
Gene Symbol Cyp2r1
Ensembl Gene ENSMUSG00000030670
Gene Namecytochrome P450, family 2, subfamily r, polypeptide 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7063 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location114549682-114562972 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 114552949 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 49 (S49P)
Ref Sequence ENSEMBL: ENSMUSP00000147544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032908] [ENSMUST00000119712] [ENSMUST00000128587] [ENSMUST00000138712] [ENSMUST00000147428] [ENSMUST00000211506]
Predicted Effect probably damaging
Transcript: ENSMUST00000032908
AA Change: S258P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032908
Gene: ENSMUSG00000030670
AA Change: S258P

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:p450 40 498 7e-122 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119712
SMART Domains Protein: ENSMUSP00000112818
Gene: ENSMUSG00000030670

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:p450 40 124 2.3e-15 PFAM
Pfam:p450 115 287 1.8e-60 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000128587
AA Change: S183P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121924
Gene: ENSMUSG00000030670
AA Change: S183P

DomainStartEndE-ValueType
Pfam:p450 1 260 5.7e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138712
SMART Domains Protein: ENSMUSP00000123556
Gene: ENSMUSG00000030670

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
SCOP:d1dt6a_ 40 76 5e-7 SMART
PDB:3CZH|B 51 76 3e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000147428
SMART Domains Protein: ENSMUSP00000119605
Gene: ENSMUSG00000030670

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
SCOP:d1dt6a_ 40 76 5e-7 SMART
PDB:3CZH|B 51 76 3e-7 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000211506
AA Change: S49P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This enzyme is a microsomal vitamin D hydroxylase that converts vitamin D into the active ligand for the vitamin D receptor. A mutation in this gene has been associated with selective 25-hydroxyvitamin D deficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit more than a 50% reduction in serum 25-hydroxyvitamin D3 levels but remain healthy and show normal serum 1alpha,25-dihydroxyvitamin D3 levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap35 A G 7: 16,565,113 V9A probably benign Het
Btbd6 A G 12: 112,977,512 Y148C probably damaging Het
C130060K24Rik A G 6: 65,441,403 probably benign Het
Casr T C 16: 36,494,574 I968V probably benign Het
Celf1 T C 2: 91,012,844 probably null Het
Chst2 G T 9: 95,405,568 R242S probably benign Het
Clca3a1 T A 3: 144,755,206 D228V probably damaging Het
Cwf19l2 A G 9: 3,430,532 Y288C probably benign Het
Dnah5 A G 15: 28,233,248 E251G probably benign Het
Eepd1 A G 9: 25,483,036 R199G possibly damaging Het
Fat1 C T 8: 45,040,775 T3986I probably benign Het
Gbp4 G A 5: 105,118,448 R576C probably damaging Het
Glp1r A G 17: 30,925,558 Y235C probably damaging Het
Gm31371 G A 8: 19,903,412 C7Y Het
Gm6408 T C 5: 146,483,784 I158T probably benign Het
Gpr89 C G 3: 96,875,698 R312P probably damaging Het
Idh2 A G 7: 80,095,684 V403A probably damaging Het
Lclat1 A G 17: 73,239,991 E301G possibly damaging Het
Lgmn A G 12: 102,402,678 Y181H probably damaging Het
Lgr5 T C 10: 115,456,734 Y417C probably damaging Het
Man1a G T 10: 54,030,744 N311K probably damaging Het
Nat10 G A 2: 103,748,077 L228F probably benign Het
Olfr1417 A G 19: 11,828,184 F281L probably damaging Het
Olfr1445 A G 19: 12,884,085 D68G probably damaging Het
Olfr476 C A 7: 107,968,204 A269E probably benign Het
Olfr958 T G 9: 39,550,115 Y252S possibly damaging Het
Pcmtd2 T A 2: 181,854,983 Y130* probably null Het
Rapgef5 A G 12: 117,689,129 D62G possibly damaging Het
Serpina3m A T 12: 104,391,467 I217L probably benign Het
Supt16 T C 14: 52,172,048 R802G possibly damaging Het
Sypl2 A T 3: 108,217,655 M130K probably benign Het
Tmtc2 A T 10: 105,348,525 L503Q probably damaging Het
Ubald2 A G 11: 116,434,617 Q60R probably benign Het
Vav1 C T 17: 57,311,860 Q673* probably null Het
Vgll2 T C 10: 52,027,976 S312P probably benign Het
Vmn1r191 C T 13: 22,178,694 A297T probably benign Het
Vmn1r7 T A 6: 57,024,433 I281F possibly damaging Het
Vmn2r108 T C 17: 20,481,148 Y30C probably damaging Het
Vmn2r16 A G 5: 109,363,784 N619S probably damaging Het
Vstm5 A G 9: 15,239,253 probably benign Het
Zfp7 A G 15: 76,891,719 I654V possibly damaging Het
Zmat2 A G 18: 36,796,574 N129S probably null Het
Other mutations in Cyp2r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00535:Cyp2r1 APN 7 114551826 missense probably benign 0.00
IGL01515:Cyp2r1 APN 7 114552712 splice site probably benign
R0178:Cyp2r1 UTSW 7 114550408 missense probably damaging 1.00
R0518:Cyp2r1 UTSW 7 114552900 missense probably benign 0.01
R0686:Cyp2r1 UTSW 7 114552011 missense possibly damaging 0.52
R1772:Cyp2r1 UTSW 7 114553216 missense probably damaging 0.99
R2044:Cyp2r1 UTSW 7 114550405 missense probably damaging 0.98
R3785:Cyp2r1 UTSW 7 114554696 missense possibly damaging 0.69
R6248:Cyp2r1 UTSW 7 114562731 critical splice donor site probably null
R6995:Cyp2r1 UTSW 7 114553081 missense probably damaging 1.00
R7048:Cyp2r1 UTSW 7 114552736 missense probably damaging 1.00
R7538:Cyp2r1 UTSW 7 114562767 missense probably damaging 1.00
R7549:Cyp2r1 UTSW 7 114554644 missense possibly damaging 0.58
R7680:Cyp2r1 UTSW 7 114552819 missense probably damaging 1.00
R7882:Cyp2r1 UTSW 7 114554589 critical splice donor site probably null
R7965:Cyp2r1 UTSW 7 114554589 critical splice donor site probably null
Z1088:Cyp2r1 UTSW 7 114551974 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTTCAGTTCCAGCAATGATG -3'
(R):5'- CCTTTTGACCTCAAGCAACTG -3'

Sequencing Primer
(F):5'- GTTCCAGCAATGATGAGTTCACC -3'
(R):5'- CTTTTGACCTCAAGCAACTGATAAC -3'
Posted On2019-05-13