Incidental Mutation 'R7063:Cwf19l2'
ID548397
Institutional Source Beutler Lab
Gene Symbol Cwf19l2
Ensembl Gene ENSMUSG00000025898
Gene NameCWF19-like 2, cell cycle control (S. pombe)
Synonyms3230401L03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.913) question?
Stock #R7063 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location3403592-3479236 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3430532 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 288 (Y288C)
Ref Sequence ENSEMBL: ENSMUSP00000027027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027027]
Predicted Effect probably benign
Transcript: ENSMUST00000027027
AA Change: Y288C

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000027027
Gene: ENSMUSG00000025898
AA Change: Y288C

DomainStartEndE-ValueType
low complexity region 64 114 N/A INTRINSIC
coiled coil region 165 196 N/A INTRINSIC
low complexity region 403 418 N/A INTRINSIC
coiled coil region 496 524 N/A INTRINSIC
Pfam:CwfJ_C_1 655 779 1.8e-40 PFAM
Pfam:CwfJ_C_2 788 882 4.6e-34 PFAM
Meta Mutation Damage Score 0.0778 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap35 A G 7: 16,565,113 V9A probably benign Het
Btbd6 A G 12: 112,977,512 Y148C probably damaging Het
C130060K24Rik A G 6: 65,441,403 probably benign Het
Casr T C 16: 36,494,574 I968V probably benign Het
Celf1 T C 2: 91,012,844 probably null Het
Chst2 G T 9: 95,405,568 R242S probably benign Het
Clca3a1 T A 3: 144,755,206 D228V probably damaging Het
Cyp2r1 A G 7: 114,552,949 S49P probably damaging Het
Dnah5 A G 15: 28,233,248 E251G probably benign Het
Eepd1 A G 9: 25,483,036 R199G possibly damaging Het
Fat1 C T 8: 45,040,775 T3986I probably benign Het
Gbp4 G A 5: 105,118,448 R576C probably damaging Het
Glp1r A G 17: 30,925,558 Y235C probably damaging Het
Gm31371 G A 8: 19,903,412 C7Y Het
Gm6408 T C 5: 146,483,784 I158T probably benign Het
Gpr89 C G 3: 96,875,698 R312P probably damaging Het
Idh2 A G 7: 80,095,684 V403A probably damaging Het
Lclat1 A G 17: 73,239,991 E301G possibly damaging Het
Lgmn A G 12: 102,402,678 Y181H probably damaging Het
Lgr5 T C 10: 115,456,734 Y417C probably damaging Het
Man1a G T 10: 54,030,744 N311K probably damaging Het
Nat10 G A 2: 103,748,077 L228F probably benign Het
Olfr1417 A G 19: 11,828,184 F281L probably damaging Het
Olfr1445 A G 19: 12,884,085 D68G probably damaging Het
Olfr476 C A 7: 107,968,204 A269E probably benign Het
Olfr958 T G 9: 39,550,115 Y252S possibly damaging Het
Pcmtd2 T A 2: 181,854,983 Y130* probably null Het
Rapgef5 A G 12: 117,689,129 D62G possibly damaging Het
Serpina3m A T 12: 104,391,467 I217L probably benign Het
Supt16 T C 14: 52,172,048 R802G possibly damaging Het
Sypl2 A T 3: 108,217,655 M130K probably benign Het
Tmtc2 A T 10: 105,348,525 L503Q probably damaging Het
Ubald2 A G 11: 116,434,617 Q60R probably benign Het
Vav1 C T 17: 57,311,860 Q673* probably null Het
Vgll2 T C 10: 52,027,976 S312P probably benign Het
Vmn1r191 C T 13: 22,178,694 A297T probably benign Het
Vmn1r7 T A 6: 57,024,433 I281F possibly damaging Het
Vmn2r108 T C 17: 20,481,148 Y30C probably damaging Het
Vmn2r16 A G 5: 109,363,784 N619S probably damaging Het
Vstm5 A G 9: 15,239,253 probably benign Het
Zfp7 A G 15: 76,891,719 I654V possibly damaging Het
Zmat2 A G 18: 36,796,574 N129S probably null Het
Other mutations in Cwf19l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Cwf19l2 APN 9 3409990 missense probably benign 0.01
IGL00573:Cwf19l2 APN 9 3450161 splice site probably benign
IGL00757:Cwf19l2 APN 9 3460054 missense probably damaging 1.00
IGL00803:Cwf19l2 APN 9 3430810 missense probably benign 0.41
IGL01916:Cwf19l2 APN 9 3477869 missense possibly damaging 0.82
IGL02315:Cwf19l2 APN 9 3410030 missense probably damaging 1.00
IGL02419:Cwf19l2 APN 9 3418777 critical splice donor site probably null
IGL02427:Cwf19l2 APN 9 3456817 missense probably benign 0.00
IGL03026:Cwf19l2 APN 9 3428777 missense probably benign 0.28
IGL03028:Cwf19l2 APN 9 3430622 missense probably benign 0.26
IGL03199:Cwf19l2 APN 9 3477830 missense probably damaging 1.00
R0015:Cwf19l2 UTSW 9 3454666 missense probably benign 0.00
R0015:Cwf19l2 UTSW 9 3454666 missense probably benign 0.00
R0532:Cwf19l2 UTSW 9 3431057 missense probably benign 0.38
R0724:Cwf19l2 UTSW 9 3421377 critical splice donor site probably null
R0924:Cwf19l2 UTSW 9 3441047 splice site probably benign
R0947:Cwf19l2 UTSW 9 3421286 missense probably benign 0.16
R1210:Cwf19l2 UTSW 9 3430810 missense probably benign 0.00
R1393:Cwf19l2 UTSW 9 3456818 missense probably benign 0.01
R1541:Cwf19l2 UTSW 9 3456760 missense probably damaging 1.00
R1594:Cwf19l2 UTSW 9 3430973 missense probably benign
R1870:Cwf19l2 UTSW 9 3458802 missense possibly damaging 0.56
R1950:Cwf19l2 UTSW 9 3418674 missense probably benign
R1996:Cwf19l2 UTSW 9 3417947 missense probably benign 0.01
R2005:Cwf19l2 UTSW 9 3430720 missense possibly damaging 0.92
R2246:Cwf19l2 UTSW 9 3430661 missense probably benign 0.16
R2420:Cwf19l2 UTSW 9 3411341 missense possibly damaging 0.80
R3051:Cwf19l2 UTSW 9 3410006 missense probably benign 0.05
R3738:Cwf19l2 UTSW 9 3456803 missense probably benign 0.01
R3915:Cwf19l2 UTSW 9 3456776 missense probably damaging 1.00
R4034:Cwf19l2 UTSW 9 3456803 missense probably benign 0.01
R4035:Cwf19l2 UTSW 9 3456803 missense probably benign 0.01
R4323:Cwf19l2 UTSW 9 3430452 missense probably damaging 0.99
R4328:Cwf19l2 UTSW 9 3458878 missense probably damaging 1.00
R4329:Cwf19l2 UTSW 9 3458878 missense probably damaging 1.00
R4692:Cwf19l2 UTSW 9 3428709 missense probably damaging 1.00
R4775:Cwf19l2 UTSW 9 3430973 missense probably benign
R4779:Cwf19l2 UTSW 9 3410035 missense possibly damaging 0.95
R4822:Cwf19l2 UTSW 9 3458839 missense probably damaging 1.00
R4833:Cwf19l2 UTSW 9 3430783 missense probably benign 0.28
R5110:Cwf19l2 UTSW 9 3450012 critical splice acceptor site probably null
R5120:Cwf19l2 UTSW 9 3418761 nonsense probably null
R5164:Cwf19l2 UTSW 9 3475511 missense probably damaging 1.00
R5440:Cwf19l2 UTSW 9 3475549 missense probably damaging 1.00
R5567:Cwf19l2 UTSW 9 3456831 missense probably damaging 1.00
R5594:Cwf19l2 UTSW 9 3418773 missense probably benign 0.42
R5960:Cwf19l2 UTSW 9 3411404 missense probably benign 0.43
R6222:Cwf19l2 UTSW 9 3454569 nonsense probably null
R6259:Cwf19l2 UTSW 9 3458879 missense probably damaging 1.00
R6688:Cwf19l2 UTSW 9 3450015 missense probably benign 0.00
R6983:Cwf19l2 UTSW 9 3477817 missense probably damaging 1.00
R7506:Cwf19l2 UTSW 9 3456775 missense probably damaging 1.00
R7733:Cwf19l2 UTSW 9 3450066 missense probably benign 0.19
R7846:Cwf19l2 UTSW 9 3477889 missense probably damaging 1.00
R7900:Cwf19l2 UTSW 9 3460107 missense probably damaging 1.00
R7929:Cwf19l2 UTSW 9 3477889 missense probably damaging 1.00
R7983:Cwf19l2 UTSW 9 3460107 missense probably damaging 1.00
T0722:Cwf19l2 UTSW 9 3456755 missense probably benign 0.00
X0003:Cwf19l2 UTSW 9 3456755 missense probably benign 0.00
X0020:Cwf19l2 UTSW 9 3418662 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATGACACAGTAGCATGAGG -3'
(R):5'- TCATCTTCATCAGAGGGTCTTAAG -3'

Sequencing Primer
(F):5'- AGGAAGACAAGAAACTGAACTTTTC -3'
(R):5'- TCTCAAATTTCCAGAAGAATCTTGG -3'
Posted On2019-05-13