Incidental Mutation 'R7063:Olfr958'
ID548400
Institutional Source Beutler Lab
Gene Symbol Olfr958
Ensembl Gene ENSMUSG00000050853
Gene Nameolfactory receptor 958
SynonymsMOR224-9, GA_x6K02T2PVTD-33247839-33246901
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R7063 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location39547958-39554054 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 39550115 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Serine at position 252 (Y252S)
Ref Sequence ENSEMBL: ENSMUSP00000149788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062545] [ENSMUST00000215505] [ENSMUST00000217227]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062545
AA Change: Y252S

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000049930
Gene: ENSMUSG00000050853
AA Change: Y252S

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 1.1e-49 PFAM
Pfam:7TM_GPCR_Srsx 36 236 1.5e-6 PFAM
Pfam:7tm_1 41 288 3.4e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215505
AA Change: Y252S

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217227
AA Change: Y252S

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap35 A G 7: 16,565,113 V9A probably benign Het
Btbd6 A G 12: 112,977,512 Y148C probably damaging Het
C130060K24Rik A G 6: 65,441,403 probably benign Het
Casr T C 16: 36,494,574 I968V probably benign Het
Celf1 T C 2: 91,012,844 probably null Het
Chst2 G T 9: 95,405,568 R242S probably benign Het
Clca3a1 T A 3: 144,755,206 D228V probably damaging Het
Cwf19l2 A G 9: 3,430,532 Y288C probably benign Het
Cyp2r1 A G 7: 114,552,949 S49P probably damaging Het
Dnah5 A G 15: 28,233,248 E251G probably benign Het
Eepd1 A G 9: 25,483,036 R199G possibly damaging Het
Fat1 C T 8: 45,040,775 T3986I probably benign Het
Gbp4 G A 5: 105,118,448 R576C probably damaging Het
Glp1r A G 17: 30,925,558 Y235C probably damaging Het
Gm31371 G A 8: 19,903,412 C7Y Het
Gm6408 T C 5: 146,483,784 I158T probably benign Het
Gpr89 C G 3: 96,875,698 R312P probably damaging Het
Idh2 A G 7: 80,095,684 V403A probably damaging Het
Lclat1 A G 17: 73,239,991 E301G possibly damaging Het
Lgmn A G 12: 102,402,678 Y181H probably damaging Het
Lgr5 T C 10: 115,456,734 Y417C probably damaging Het
Man1a G T 10: 54,030,744 N311K probably damaging Het
Nat10 G A 2: 103,748,077 L228F probably benign Het
Olfr1417 A G 19: 11,828,184 F281L probably damaging Het
Olfr1445 A G 19: 12,884,085 D68G probably damaging Het
Olfr476 C A 7: 107,968,204 A269E probably benign Het
Pcmtd2 T A 2: 181,854,983 Y130* probably null Het
Rapgef5 A G 12: 117,689,129 D62G possibly damaging Het
Serpina3m A T 12: 104,391,467 I217L probably benign Het
Supt16 T C 14: 52,172,048 R802G possibly damaging Het
Sypl2 A T 3: 108,217,655 M130K probably benign Het
Tmtc2 A T 10: 105,348,525 L503Q probably damaging Het
Ubald2 A G 11: 116,434,617 Q60R probably benign Het
Vav1 C T 17: 57,311,860 Q673* probably null Het
Vgll2 T C 10: 52,027,976 S312P probably benign Het
Vmn1r191 C T 13: 22,178,694 A297T probably benign Het
Vmn1r7 T A 6: 57,024,433 I281F possibly damaging Het
Vmn2r108 T C 17: 20,481,148 Y30C probably damaging Het
Vmn2r16 A G 5: 109,363,784 N619S probably damaging Het
Vstm5 A G 9: 15,239,253 probably benign Het
Zfp7 A G 15: 76,891,719 I654V possibly damaging Het
Zmat2 A G 18: 36,796,574 N129S probably null Het
Other mutations in Olfr958
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0446:Olfr958 UTSW 9 39550451 missense probably damaging 0.96
R0539:Olfr958 UTSW 9 39550297 missense probably damaging 0.99
R1512:Olfr958 UTSW 9 39550094 missense probably damaging 1.00
R1521:Olfr958 UTSW 9 39550784 missense possibly damaging 0.65
R1652:Olfr958 UTSW 9 39550295 missense probably benign 0.03
R2099:Olfr958 UTSW 9 39550667 missense probably benign 0.17
R2252:Olfr958 UTSW 9 39549977 missense probably damaging 0.99
R2911:Olfr958 UTSW 9 39550821 missense possibly damaging 0.76
R3722:Olfr958 UTSW 9 39550122 missense probably damaging 1.00
R5745:Olfr958 UTSW 9 39550691 missense probably damaging 1.00
R6460:Olfr958 UTSW 9 39550792 frame shift probably null
R6504:Olfr958 UTSW 9 39550278 missense probably damaging 1.00
R7162:Olfr958 UTSW 9 39550229 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTTCCTAACCCTCAGAAACTGAC -3'
(R):5'- ACCAGCCATCTTGCCATTGG -3'

Sequencing Primer
(F):5'- GAAACTGACCCCTTCCCATG -3'
(R):5'- TGCTGATACCTCCTTAGCACAGAG -3'
Posted On2019-05-13