Incidental Mutation 'R7063:Vgll2'
ID548402
Institutional Source Beutler Lab
Gene Symbol Vgll2
Ensembl Gene ENSMUSG00000049641
Gene Namevestigial like family member 2
SynonymsC130057C21Rik, Vito1, VITO-1, Vgl-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.775) question?
Stock #R7063 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location52022502-52028471 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52027976 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 312 (S312P)
Ref Sequence ENSEMBL: ENSMUSP00000124091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058347] [ENSMUST00000163017]
Predicted Effect probably benign
Transcript: ENSMUST00000058347
AA Change: S311P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000050273
Gene: ENSMUSG00000049641
AA Change: S311P

DomainStartEndE-ValueType
low complexity region 42 61 N/A INTRINSIC
Pfam:Vg_Tdu 78 110 7.6e-27 PFAM
low complexity region 192 204 N/A INTRINSIC
low complexity region 206 213 N/A INTRINSIC
low complexity region 245 262 N/A INTRINSIC
low complexity region 269 282 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163017
AA Change: S312P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000124091
Gene: ENSMUSG00000049641
AA Change: S312P

DomainStartEndE-ValueType
low complexity region 42 61 N/A INTRINSIC
Pfam:Vg_Tdu 78 108 1.1e-23 PFAM
low complexity region 193 205 N/A INTRINSIC
low complexity region 207 214 N/A INTRINSIC
low complexity region 246 263 N/A INTRINSIC
low complexity region 270 283 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: This gene is a member of the Vestigial-like (Vgl) gene family and is upregulated during muscle differentiation. The product of this gene interacts with and modifies the DNA-binding properties of the transcription factor, TEF-1, and is important for muscle tissue development. Reduced expression of this gene leads to a reduction in the terminal differentiation of muscle cells. Alternate splicing results in multiple protein isoforms. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap35 A G 7: 16,565,113 V9A probably benign Het
Btbd6 A G 12: 112,977,512 Y148C probably damaging Het
C130060K24Rik A G 6: 65,441,403 probably benign Het
Casr T C 16: 36,494,574 I968V probably benign Het
Celf1 T C 2: 91,012,844 probably null Het
Chst2 G T 9: 95,405,568 R242S probably benign Het
Clca3a1 T A 3: 144,755,206 D228V probably damaging Het
Cwf19l2 A G 9: 3,430,532 Y288C probably benign Het
Cyp2r1 A G 7: 114,552,949 S49P probably damaging Het
Dnah5 A G 15: 28,233,248 E251G probably benign Het
Eepd1 A G 9: 25,483,036 R199G possibly damaging Het
Fat1 C T 8: 45,040,775 T3986I probably benign Het
Gbp4 G A 5: 105,118,448 R576C probably damaging Het
Glp1r A G 17: 30,925,558 Y235C probably damaging Het
Gm31371 G A 8: 19,903,412 C7Y Het
Gm6408 T C 5: 146,483,784 I158T probably benign Het
Gpr89 C G 3: 96,875,698 R312P probably damaging Het
Idh2 A G 7: 80,095,684 V403A probably damaging Het
Lclat1 A G 17: 73,239,991 E301G possibly damaging Het
Lgmn A G 12: 102,402,678 Y181H probably damaging Het
Lgr5 T C 10: 115,456,734 Y417C probably damaging Het
Man1a G T 10: 54,030,744 N311K probably damaging Het
Nat10 G A 2: 103,748,077 L228F probably benign Het
Olfr1417 A G 19: 11,828,184 F281L probably damaging Het
Olfr1445 A G 19: 12,884,085 D68G probably damaging Het
Olfr476 C A 7: 107,968,204 A269E probably benign Het
Olfr958 T G 9: 39,550,115 Y252S possibly damaging Het
Pcmtd2 T A 2: 181,854,983 Y130* probably null Het
Rapgef5 A G 12: 117,689,129 D62G possibly damaging Het
Serpina3m A T 12: 104,391,467 I217L probably benign Het
Supt16 T C 14: 52,172,048 R802G possibly damaging Het
Sypl2 A T 3: 108,217,655 M130K probably benign Het
Tmtc2 A T 10: 105,348,525 L503Q probably damaging Het
Ubald2 A G 11: 116,434,617 Q60R probably benign Het
Vav1 C T 17: 57,311,860 Q673* probably null Het
Vmn1r191 C T 13: 22,178,694 A297T probably benign Het
Vmn1r7 T A 6: 57,024,433 I281F possibly damaging Het
Vmn2r108 T C 17: 20,481,148 Y30C probably damaging Het
Vmn2r16 A G 5: 109,363,784 N619S probably damaging Het
Vstm5 A G 9: 15,239,253 probably benign Het
Zfp7 A G 15: 76,891,719 I654V possibly damaging Het
Zmat2 A G 18: 36,796,574 N129S probably null Het
Other mutations in Vgll2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02436:Vgll2 APN 10 52025222 nonsense probably null
R1796:Vgll2 UTSW 10 52025228 missense probably damaging 1.00
R5193:Vgll2 UTSW 10 52027992 missense possibly damaging 0.96
R5397:Vgll2 UTSW 10 52025166 missense probably damaging 1.00
R5614:Vgll2 UTSW 10 52025222 nonsense probably null
R5766:Vgll2 UTSW 10 52027563 missense probably damaging 1.00
R5842:Vgll2 UTSW 10 52025292 missense probably damaging 1.00
R7272:Vgll2 UTSW 10 52027662 missense possibly damaging 0.76
Z1176:Vgll2 UTSW 10 52027602 missense possibly damaging 0.94
Z1177:Vgll2 UTSW 10 52027808 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- TGACTGCCGTGACACTCTTC -3'
(R):5'- TGCTACTTCCTAAAGACATCTACC -3'

Sequencing Primer
(F):5'- AGCAGTGCACGAGGTCTAC -3'
(R):5'- TCTACCCGTAGAAACAAATGATGG -3'
Posted On2019-05-13