Incidental Mutation 'R7063:Serpina3m'
ID548408
Institutional Source Beutler Lab
Gene Symbol Serpina3m
Ensembl Gene ENSMUSG00000079012
Gene Nameserine (or cysteine) peptidase inhibitor, clade A, member 3M
Synonymsantitrypsin, Spi2.4, alpha-1 antiproteinase, MMSPi2.4, contrapsin-like, Spi-2l, Spi-2rs1, 3e46, MMCM7, Spi2-rs1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R7063 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location104338486-104394257 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104391467 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 217 (I217L)
Ref Sequence ENSEMBL: ENSMUSP00000130979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101078] [ENSMUST00000168797]
Predicted Effect probably benign
Transcript: ENSMUST00000101078
AA Change: I217L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000098639
Gene: ENSMUSG00000079012
AA Change: I217L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SERPIN 56 417 3.12e-199 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168797
AA Change: I217L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000130979
Gene: ENSMUSG00000079012
AA Change: I217L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SERPIN 56 417 3.12e-199 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap35 A G 7: 16,565,113 V9A probably benign Het
Btbd6 A G 12: 112,977,512 Y148C probably damaging Het
C130060K24Rik A G 6: 65,441,403 probably benign Het
Casr T C 16: 36,494,574 I968V probably benign Het
Celf1 T C 2: 91,012,844 probably null Het
Chst2 G T 9: 95,405,568 R242S probably benign Het
Clca3a1 T A 3: 144,755,206 D228V probably damaging Het
Cwf19l2 A G 9: 3,430,532 Y288C probably benign Het
Cyp2r1 A G 7: 114,552,949 S49P probably damaging Het
Dnah5 A G 15: 28,233,248 E251G probably benign Het
Eepd1 A G 9: 25,483,036 R199G possibly damaging Het
Fat1 C T 8: 45,040,775 T3986I probably benign Het
Gbp4 G A 5: 105,118,448 R576C probably damaging Het
Glp1r A G 17: 30,925,558 Y235C probably damaging Het
Gm31371 G A 8: 19,903,412 C7Y Het
Gm6408 T C 5: 146,483,784 I158T probably benign Het
Gpr89 C G 3: 96,875,698 R312P probably damaging Het
Idh2 A G 7: 80,095,684 V403A probably damaging Het
Lclat1 A G 17: 73,239,991 E301G possibly damaging Het
Lgmn A G 12: 102,402,678 Y181H probably damaging Het
Lgr5 T C 10: 115,456,734 Y417C probably damaging Het
Man1a G T 10: 54,030,744 N311K probably damaging Het
Nat10 G A 2: 103,748,077 L228F probably benign Het
Olfr1417 A G 19: 11,828,184 F281L probably damaging Het
Olfr1445 A G 19: 12,884,085 D68G probably damaging Het
Olfr476 C A 7: 107,968,204 A269E probably benign Het
Olfr958 T G 9: 39,550,115 Y252S possibly damaging Het
Pcmtd2 T A 2: 181,854,983 Y130* probably null Het
Rapgef5 A G 12: 117,689,129 D62G possibly damaging Het
Supt16 T C 14: 52,172,048 R802G possibly damaging Het
Sypl2 A T 3: 108,217,655 M130K probably benign Het
Tmtc2 A T 10: 105,348,525 L503Q probably damaging Het
Ubald2 A G 11: 116,434,617 Q60R probably benign Het
Vav1 C T 17: 57,311,860 Q673* probably null Het
Vgll2 T C 10: 52,027,976 S312P probably benign Het
Vmn1r191 C T 13: 22,178,694 A297T probably benign Het
Vmn1r7 T A 6: 57,024,433 I281F possibly damaging Het
Vmn2r108 T C 17: 20,481,148 Y30C probably damaging Het
Vmn2r16 A G 5: 109,363,784 N619S probably damaging Het
Vstm5 A G 9: 15,239,253 probably benign Het
Zfp7 A G 15: 76,891,719 I654V possibly damaging Het
Zmat2 A G 18: 36,796,574 N129S probably null Het
Other mutations in Serpina3m
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4976:Serpina3m UTSW 12 104358623 intron probably null
R1797:Serpina3m UTSW 12 104389515 missense probably damaging 1.00
R1929:Serpina3m UTSW 12 104389322 missense probably damaging 0.97
R1991:Serpina3m UTSW 12 104389699 nonsense probably null
R2032:Serpina3m UTSW 12 104389669 missense probably benign 0.00
R2094:Serpina3m UTSW 12 104389270 missense probably benign 0.35
R2103:Serpina3m UTSW 12 104389699 nonsense probably null
R2121:Serpina3m UTSW 12 104389682 missense possibly damaging 0.59
R2147:Serpina3m UTSW 12 104389224 missense probably benign 0.01
R2241:Serpina3m UTSW 12 104389449 missense probably benign 0.01
R2330:Serpina3m UTSW 12 104391704 missense possibly damaging 0.61
R4057:Serpina3m UTSW 12 104391737 splice site probably benign
R4275:Serpina3m UTSW 12 104389116 missense probably damaging 0.99
R4466:Serpina3m UTSW 12 104391615 missense probably damaging 1.00
R4901:Serpina3m UTSW 12 104389649 nonsense probably null
R4924:Serpina3m UTSW 12 104391470 missense probably benign 0.00
R4964:Serpina3m UTSW 12 104389101 missense probably benign 0.43
R5723:Serpina3m UTSW 12 104393911 missense probably damaging 0.96
R5836:Serpina3m UTSW 12 104389250 missense probably damaging 1.00
R6172:Serpina3m UTSW 12 104389227 missense probably damaging 1.00
R6619:Serpina3m UTSW 12 104391507 missense probably benign 0.02
R6857:Serpina3m UTSW 12 104389326 missense probably damaging 1.00
R6886:Serpina3m UTSW 12 104389127 missense possibly damaging 0.94
R7170:Serpina3m UTSW 12 104389518 missense probably damaging 1.00
R7622:Serpina3m UTSW 12 104389575 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GCTAGCAGCTTGGTCAACTACC -3'
(R):5'- GGTTGTAAGCTGGCTTCCAC -3'

Sequencing Primer
(F):5'- AAGGGACACTCTGAGTGA -3'
(R):5'- TGCATCCTGCCCTGGTCAG -3'
Posted On2019-05-13