Incidental Mutation 'R7064:Rnf20'
ID 548435
Institutional Source Beutler Lab
Gene Symbol Rnf20
Ensembl Gene ENSMUSG00000028309
Gene Name ring finger protein 20
Synonyms 4833430L21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7064 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 49632006-49656887 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 49644580 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 282 (R282*)
Ref Sequence ENSEMBL: ENSMUSP00000128546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029989] [ENSMUST00000146547] [ENSMUST00000156314] [ENSMUST00000167496]
AlphaFold Q5DTM8
Predicted Effect probably null
Transcript: ENSMUST00000029989
AA Change: R282*
SMART Domains Protein: ENSMUSP00000029989
Gene: ENSMUSG00000028309
AA Change: R282*

DomainStartEndE-ValueType
coiled coil region 45 85 N/A INTRINSIC
coiled coil region 172 200 N/A INTRINSIC
coiled coil region 317 378 N/A INTRINSIC
coiled coil region 429 514 N/A INTRINSIC
coiled coil region 550 733 N/A INTRINSIC
coiled coil region 769 805 N/A INTRINSIC
coiled coil region 828 867 N/A INTRINSIC
RING 920 958 2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146547
SMART Domains Protein: ENSMUSP00000120668
Gene: ENSMUSG00000028309

DomainStartEndE-ValueType
coiled coil region 45 85 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000156314
AA Change: R282*
SMART Domains Protein: ENSMUSP00000118293
Gene: ENSMUSG00000028309
AA Change: R282*

DomainStartEndE-ValueType
coiled coil region 45 85 N/A INTRINSIC
low complexity region 164 172 N/A INTRINSIC
SCOP:d1gw5a_ 174 294 3e-3 SMART
coiled coil region 317 378 N/A INTRINSIC
coiled coil region 429 514 N/A INTRINSIC
coiled coil region 550 606 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000167496
AA Change: R282*
SMART Domains Protein: ENSMUSP00000128546
Gene: ENSMUSG00000028309
AA Change: R282*

DomainStartEndE-ValueType
coiled coil region 45 85 N/A INTRINSIC
coiled coil region 172 200 N/A INTRINSIC
coiled coil region 317 378 N/A INTRINSIC
coiled coil region 429 514 N/A INTRINSIC
coiled coil region 550 733 N/A INTRINSIC
coiled coil region 769 805 N/A INTRINSIC
coiled coil region 828 867 N/A INTRINSIC
RING 920 958 2e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with BRE1 of S. cerevisiae. The protein encoded by this human gene is an E3 ubiquitin ligase that regulates chromosome structure by monoubiquitinating histone H2B. This protein acts as a putative tumor suppressor and positively regulates the p53 tumor suppressor as well as numerous histone H2A and H2B genes. In contrast, this protein also suppresses the expression of several protooncogenes and growth-related genes, including many genes that are induced by epidermal growth factor. This gene selectively suppresses the expression of some genes by interfering with chromatin recruitment of transcription elongation factor SII (TFIIS). [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T C 8: 60,531,712 I263T probably damaging Het
Adamtsl1 C T 4: 86,342,041 P830S possibly damaging Het
Adrb1 T C 19: 56,723,024 F218S probably damaging Het
Ahnak2 T C 12: 112,780,742 probably benign Het
Arsj T A 3: 126,438,337 V244E probably damaging Het
Atm T C 9: 53,507,881 E757G probably benign Het
AU040320 A G 4: 126,792,072 D147G probably benign Het
Btnl10 A T 11: 58,919,308 M92L possibly damaging Het
Chd6 T C 2: 160,950,063 D2458G probably damaging Het
Cntn3 T C 6: 102,273,811 I259V probably damaging Het
Ctns A G 11: 73,186,392 V250A probably benign Het
Cxxc1 T A 18: 74,220,607 probably null Het
Cyp2a4 A T 7: 26,312,307 M318L probably benign Het
Dchs1 A G 7: 105,763,185 L1302P probably damaging Het
Decr1 C A 4: 15,945,392 Het
Dmbx1 T C 4: 115,918,268 N272D probably damaging Het
Dsel C A 1: 111,862,847 probably benign Het
Dspp A C 5: 104,176,938 D389A possibly damaging Het
Ero1l T C 14: 45,306,592 T52A probably damaging Het
Fam186a T C 15: 99,941,676 E2229G unknown Het
Fam208a C T 14: 27,472,331 P1163S probably benign Het
Gabrd C T 4: 155,388,346 V127M probably damaging Het
Gpc2 A T 5: 138,278,910 F85Y probably damaging Het
Gucy2g A G 19: 55,210,332 L793S probably benign Het
Itpr3 G C 17: 27,089,295 G298R probably damaging Het
Kalrn A T 16: 34,217,891 C1024S probably damaging Het
Krt40 T C 11: 99,540,128 Y185C probably benign Het
Lmo7 G A 14: 101,884,179 D227N probably damaging Het
Mmrn1 T A 6: 60,988,540 L1184* probably null Het
Mrvi1 C G 7: 110,895,854 E455Q probably damaging Het
Olfr113 T A 17: 37,574,743 R227W probably damaging Het
Olfr1211 T A 2: 88,929,509 M269L probably benign Het
Olfr982 T A 9: 40,074,813 Y173N probably damaging Het
Parp9 T G 16: 35,953,672 V338G probably benign Het
Pcdh15 G A 10: 74,630,614 E888K possibly damaging Het
Pcdh9 C T 14: 93,886,149 E862K probably damaging Het
Prkdc A G 16: 15,790,453 T3040A probably benign Het
Qser1 T C 2: 104,787,119 E1026G probably damaging Het
Rpgrip1l T A 8: 91,263,520 K765* probably null Het
Rprd2 G A 3: 95,765,016 T1025M probably damaging Het
Scn4a A G 11: 106,322,157 Y1341H possibly damaging Het
Scn5a C G 9: 119,489,911 D1554H probably damaging Het
Sept14 T C 5: 129,697,806 I102V probably benign Het
Sept4 A G 11: 87,590,367 T378A probably benign Het
Siglec1 C T 2: 131,083,914 G291R probably benign Het
Sik2 A G 9: 50,907,420 V418A probably damaging Het
Slc9a5 A G 8: 105,349,446 T24A possibly damaging Het
Spata31d1b T C 13: 59,716,141 S368P probably benign Het
Stip1 T C 19: 7,035,557 D53G probably benign Het
Stk36 T C 1: 74,610,820 W245R probably damaging Het
Stk39 A T 2: 68,358,812 probably null Het
Tacr2 T C 10: 62,261,497 M252T probably damaging Het
Terb1 A T 8: 104,488,554 N263K probably benign Het
Tgm5 T C 2: 121,053,514 M333V probably benign Het
Tmem45a T C 16: 56,822,404 M135V probably benign Het
Trmt13 T A 3: 116,582,697 K348N probably damaging Het
Trmt2a A T 16: 18,253,004 M534L probably damaging Het
Ttll13 G A 7: 80,257,030 R513K probably null Het
Vmn1r228 T A 17: 20,777,023 I78L probably benign Het
Washc3 T C 10: 88,245,773 V173A possibly damaging Het
Zc2hc1b A T 10: 13,171,305 C21S probably damaging Het
Zfp944 T A 17: 22,339,579 H229L probably damaging Het
Zfp985 T A 4: 147,583,116 I147N probably benign Het
Other mutations in Rnf20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Rnf20 APN 4 49655480 nonsense probably null
IGL01319:Rnf20 APN 4 49649326 missense probably damaging 0.99
IGL01666:Rnf20 APN 4 49654486 nonsense probably null
IGL01975:Rnf20 APN 4 49654473 missense probably benign 0.00
IGL02130:Rnf20 APN 4 49644481 splice site probably benign
IGL02179:Rnf20 APN 4 49638712 missense probably benign 0.04
IGL03096:Rnf20 APN 4 49638615 splice site probably benign
IGL03120:Rnf20 APN 4 49649955 splice site probably benign
IGL03208:Rnf20 APN 4 49645706 splice site probably benign
IGL03257:Rnf20 APN 4 49645687 missense probably benign 0.19
IGL03349:Rnf20 APN 4 49655936 missense probably damaging 1.00
R0372:Rnf20 UTSW 4 49650176 missense possibly damaging 0.53
R0486:Rnf20 UTSW 4 49645907 missense possibly damaging 0.57
R0791:Rnf20 UTSW 4 49638197 missense possibly damaging 0.92
R0927:Rnf20 UTSW 4 49642176 missense probably damaging 1.00
R1256:Rnf20 UTSW 4 49638230 missense probably benign 0.33
R1272:Rnf20 UTSW 4 49651496 missense probably damaging 0.99
R1460:Rnf20 UTSW 4 49645873 splice site probably benign
R1522:Rnf20 UTSW 4 49638197 missense possibly damaging 0.92
R1698:Rnf20 UTSW 4 49651498 nonsense probably null
R1848:Rnf20 UTSW 4 49644628 missense probably damaging 1.00
R2214:Rnf20 UTSW 4 49648344 missense possibly damaging 0.77
R2497:Rnf20 UTSW 4 49652676 splice site probably null
R2915:Rnf20 UTSW 4 49638769 missense probably benign 0.13
R4726:Rnf20 UTSW 4 49654579 nonsense probably null
R4770:Rnf20 UTSW 4 49633412 critical splice donor site probably null
R4799:Rnf20 UTSW 4 49649962 critical splice acceptor site probably null
R4960:Rnf20 UTSW 4 49638029 missense probably damaging 0.99
R5022:Rnf20 UTSW 4 49642016 intron probably benign
R5146:Rnf20 UTSW 4 49651456 missense probably benign 0.21
R5379:Rnf20 UTSW 4 49652639 missense possibly damaging 0.47
R5423:Rnf20 UTSW 4 49644620 missense probably damaging 0.99
R6297:Rnf20 UTSW 4 49642132 missense probably damaging 1.00
R6608:Rnf20 UTSW 4 49650051 missense probably benign 0.05
R7776:Rnf20 UTSW 4 49644592 nonsense probably null
R8735:Rnf20 UTSW 4 49655964 missense possibly damaging 0.95
R8995:Rnf20 UTSW 4 49648437 missense possibly damaging 0.94
Z1177:Rnf20 UTSW 4 49645655 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCTGTAGCAGTCTAAGAACTTTTC -3'
(R):5'- GGGATCTAATACCCTCTTCTGGCC -3'

Sequencing Primer
(F):5'- TGTGAGCAAGGACTAATTTTATGG -3'
(R):5'- TCTTCTGGCCTCCACAGG -3'
Posted On 2019-05-13