Mutagenetix > Incidental Mutations

Incidental Mutation 'R7064:Rnf20'

548435

Institutional Source

Beutler Lab

Gene Symbol

Rnf20

Ensembl Gene

ENSMUSG00000028309

Gene Name

ring finger protein 20

Synonyms

4833430L21Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7064 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

49632006-49656887 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 49644580 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 282 (R282*)

Ref Sequence

ENSEMBL: ENSMUSP00000128546 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029989] [ENSMUST00000146547] [ENSMUST00000156314] [ENSMUST00000167496]

AlphaFold

Q5DTM8

Predicted Effect

probably null
Transcript: ENSMUST00000029989
AA Change: R282*

SMART Domains

Protein: ENSMUSP00000029989
Gene: ENSMUSG00000028309
AA Change: R282*

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC
coiled coil region	172	200	N/A	INTRINSIC
coiled coil region	317	378	N/A	INTRINSIC
coiled coil region	429	514	N/A	INTRINSIC
coiled coil region	550	733	N/A	INTRINSIC
coiled coil region	769	805	N/A	INTRINSIC
coiled coil region	828	867	N/A	INTRINSIC
RING	920	958	2e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000146547

SMART Domains

Protein: ENSMUSP00000120668
Gene: ENSMUSG00000028309

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000156314
AA Change: R282*

SMART Domains

Protein: ENSMUSP00000118293
Gene: ENSMUSG00000028309
AA Change: R282*

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC
low complexity region	164	172	N/A	INTRINSIC
SCOP:d1gw5a_	174	294	3e-3	SMART
coiled coil region	317	378	N/A	INTRINSIC
coiled coil region	429	514	N/A	INTRINSIC
coiled coil region	550	606	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000167496
AA Change: R282*

SMART Domains

Protein: ENSMUSP00000128546
Gene: ENSMUSG00000028309
AA Change: R282*

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC
coiled coil region	172	200	N/A	INTRINSIC
coiled coil region	317	378	N/A	INTRINSIC
coiled coil region	429	514	N/A	INTRINSIC
coiled coil region	550	733	N/A	INTRINSIC
coiled coil region	769	805	N/A	INTRINSIC
coiled coil region	828	867	N/A	INTRINSIC
RING	920	958	2e-4	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with BRE1 of S. cerevisiae. The protein encoded by this human gene is an E3 ubiquitin ligase that regulates chromosome structure by monoubiquitinating histone H2B. This protein acts as a putative tumor suppressor and positively regulates the p53 tumor suppressor as well as numerous histone H2A and H2B genes. In contrast, this protein also suppresses the expression of several protooncogenes and growth-related genes, including many genes that are induced by epidermal growth factor. This gene selectively suppresses the expression of some genes by interfering with chromatin recruitment of transcription elongation factor SII (TFIIS). [provided by RefSeq, Feb 2012]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadat	T	C	8: 60,531,712	I263T	probably damaging	Het
Adamtsl1	C	T	4: 86,342,041	P830S	possibly damaging	Het
Adrb1	T	C	19: 56,723,024	F218S	probably damaging	Het
Ahnak2	T	C	12: 112,780,742		probably benign	Het
Arsj	T	A	3: 126,438,337	V244E	probably damaging	Het
Atm	T	C	9: 53,507,881	E757G	probably benign	Het
AU040320	A	G	4: 126,792,072	D147G	probably benign	Het
Btnl10	A	T	11: 58,919,308	M92L	possibly damaging	Het
Chd6	T	C	2: 160,950,063	D2458G	probably damaging	Het
Cntn3	T	C	6: 102,273,811	I259V	probably damaging	Het
Ctns	A	G	11: 73,186,392	V250A	probably benign	Het
Cxxc1	T	A	18: 74,220,607		probably null	Het
Cyp2a4	A	T	7: 26,312,307	M318L	probably benign	Het
Dchs1	A	G	7: 105,763,185	L1302P	probably damaging	Het
Decr1	C	A	4: 15,945,392			Het
Dmbx1	T	C	4: 115,918,268	N272D	probably damaging	Het
Dsel	C	A	1: 111,862,847		probably benign	Het
Dspp	A	C	5: 104,176,938	D389A	possibly damaging	Het
Ero1l	T	C	14: 45,306,592	T52A	probably damaging	Het
Fam186a	T	C	15: 99,941,676	E2229G	unknown	Het
Fam208a	C	T	14: 27,472,331	P1163S	probably benign	Het
Gabrd	C	T	4: 155,388,346	V127M	probably damaging	Het
Gpc2	A	T	5: 138,278,910	F85Y	probably damaging	Het
Gucy2g	A	G	19: 55,210,332	L793S	probably benign	Het
Itpr3	G	C	17: 27,089,295	G298R	probably damaging	Het
Kalrn	A	T	16: 34,217,891	C1024S	probably damaging	Het
Krt40	T	C	11: 99,540,128	Y185C	probably benign	Het
Lmo7	G	A	14: 101,884,179	D227N	probably damaging	Het
Mmrn1	T	A	6: 60,988,540	L1184*	probably null	Het
Mrvi1	C	G	7: 110,895,854	E455Q	probably damaging	Het
Olfr113	T	A	17: 37,574,743	R227W	probably damaging	Het
Olfr1211	T	A	2: 88,929,509	M269L	probably benign	Het
Olfr982	T	A	9: 40,074,813	Y173N	probably damaging	Het
Parp9	T	G	16: 35,953,672	V338G	probably benign	Het
Pcdh15	G	A	10: 74,630,614	E888K	possibly damaging	Het
Pcdh9	C	T	14: 93,886,149	E862K	probably damaging	Het
Prkdc	A	G	16: 15,790,453	T3040A	probably benign	Het
Qser1	T	C	2: 104,787,119	E1026G	probably damaging	Het
Rpgrip1l	T	A	8: 91,263,520	K765*	probably null	Het
Rprd2	G	A	3: 95,765,016	T1025M	probably damaging	Het
Scn4a	A	G	11: 106,322,157	Y1341H	possibly damaging	Het
Scn5a	C	G	9: 119,489,911	D1554H	probably damaging	Het
Sept14	T	C	5: 129,697,806	I102V	probably benign	Het
Sept4	A	G	11: 87,590,367	T378A	probably benign	Het
Siglec1	C	T	2: 131,083,914	G291R	probably benign	Het
Sik2	A	G	9: 50,907,420	V418A	probably damaging	Het
Slc9a5	A	G	8: 105,349,446	T24A	possibly damaging	Het
Spata31d1b	T	C	13: 59,716,141	S368P	probably benign	Het
Stip1	T	C	19: 7,035,557	D53G	probably benign	Het
Stk36	T	C	1: 74,610,820	W245R	probably damaging	Het
Stk39	A	T	2: 68,358,812		probably null	Het
Tacr2	T	C	10: 62,261,497	M252T	probably damaging	Het
Terb1	A	T	8: 104,488,554	N263K	probably benign	Het
Tgm5	T	C	2: 121,053,514	M333V	probably benign	Het
Tmem45a	T	C	16: 56,822,404	M135V	probably benign	Het
Trmt13	T	A	3: 116,582,697	K348N	probably damaging	Het
Trmt2a	A	T	16: 18,253,004	M534L	probably damaging	Het
Ttll13	G	A	7: 80,257,030	R513K	probably null	Het
Vmn1r228	T	A	17: 20,777,023	I78L	probably benign	Het
Washc3	T	C	10: 88,245,773	V173A	possibly damaging	Het
Zc2hc1b	A	T	10: 13,171,305	C21S	probably damaging	Het
Zfp944	T	A	17: 22,339,579	H229L	probably damaging	Het
Zfp985	T	A	4: 147,583,116	I147N	probably benign	Het

Other mutations in Rnf20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00467:Rnf20	APN	4	49655480	nonsense	probably null
IGL01319:Rnf20	APN	4	49649326	missense	probably damaging	0.99
IGL01666:Rnf20	APN	4	49654486	nonsense	probably null
IGL01975:Rnf20	APN	4	49654473	missense	probably benign	0.00
IGL02130:Rnf20	APN	4	49644481	splice site	probably benign
IGL02179:Rnf20	APN	4	49638712	missense	probably benign	0.04
IGL03096:Rnf20	APN	4	49638615	splice site	probably benign
IGL03120:Rnf20	APN	4	49649955	splice site	probably benign
IGL03208:Rnf20	APN	4	49645706	splice site	probably benign
IGL03257:Rnf20	APN	4	49645687	missense	probably benign	0.19
IGL03349:Rnf20	APN	4	49655936	missense	probably damaging	1.00
R0372:Rnf20	UTSW	4	49650176	missense	possibly damaging	0.53
R0486:Rnf20	UTSW	4	49645907	missense	possibly damaging	0.57
R0791:Rnf20	UTSW	4	49638197	missense	possibly damaging	0.92
R0927:Rnf20	UTSW	4	49642176	missense	probably damaging	1.00
R1256:Rnf20	UTSW	4	49638230	missense	probably benign	0.33
R1272:Rnf20	UTSW	4	49651496	missense	probably damaging	0.99
R1460:Rnf20	UTSW	4	49645873	splice site	probably benign
R1522:Rnf20	UTSW	4	49638197	missense	possibly damaging	0.92
R1698:Rnf20	UTSW	4	49651498	nonsense	probably null
R1848:Rnf20	UTSW	4	49644628	missense	probably damaging	1.00
R2214:Rnf20	UTSW	4	49648344	missense	possibly damaging	0.77
R2497:Rnf20	UTSW	4	49652676	splice site	probably null
R2915:Rnf20	UTSW	4	49638769	missense	probably benign	0.13
R4726:Rnf20	UTSW	4	49654579	nonsense	probably null
R4770:Rnf20	UTSW	4	49633412	critical splice donor site	probably null
R4799:Rnf20	UTSW	4	49649962	critical splice acceptor site	probably null
R4960:Rnf20	UTSW	4	49638029	missense	probably damaging	0.99
R5022:Rnf20	UTSW	4	49642016	intron	probably benign
R5146:Rnf20	UTSW	4	49651456	missense	probably benign	0.21
R5379:Rnf20	UTSW	4	49652639	missense	possibly damaging	0.47
R5423:Rnf20	UTSW	4	49644620	missense	probably damaging	0.99
R6297:Rnf20	UTSW	4	49642132	missense	probably damaging	1.00
R6608:Rnf20	UTSW	4	49650051	missense	probably benign	0.05
R7776:Rnf20	UTSW	4	49644592	nonsense	probably null
R8735:Rnf20	UTSW	4	49655964	missense	possibly damaging	0.95
R8995:Rnf20	UTSW	4	49648437	missense	possibly damaging	0.94
Z1177:Rnf20	UTSW	4	49645655	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CCTGTAGCAGTCTAAGAACTTTTC -3'
(R):5'- GGGATCTAATACCCTCTTCTGGCC -3'

Sequencing Primer
(F):5'- TGTGAGCAAGGACTAATTTTATGG -3'
(R):5'- TCTTCTGGCCTCCACAGG -3'

Posted On

2019-05-13