Incidental Mutation 'R7064:Gabrd'
ID548440
Institutional Source Beutler Lab
Gene Symbol Gabrd
Ensembl Gene ENSMUSG00000029054
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit delta
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R7064 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location155384980-155398112 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 155388346 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 127 (V127M)
Ref Sequence ENSEMBL: ENSMUSP00000030925 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030925]
Predicted Effect probably damaging
Transcript: ENSMUST00000030925
AA Change: V127M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030925
Gene: ENSMUSG00000029054
AA Change: V127M

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Neur_chan_LBD 43 247 9.8e-48 PFAM
Pfam:Neur_chan_memb 254 402 6.5e-34 PFAM
transmembrane domain 426 448 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Gamma-aminobutyric acid (GABA) is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. The GABA-A receptor is generally pentameric and there are five types of subunits: alpha, beta, gamma, delta, and rho. This gene encodes the delta subunit. Mutations in this gene have been associated with susceptibility to generalized epilepsy with febrile seizures, type 5. Alternatively spliced transcript variants have been described for this gene, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased postpartum depression and anxiety behaviors, lethality of pups due to materal neglect, and increased cued and contextual conditional freezing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T C 8: 60,531,712 I263T probably damaging Het
Adamtsl1 C T 4: 86,342,041 P830S possibly damaging Het
Adrb1 T C 19: 56,723,024 F218S probably damaging Het
Ahnak2 T C 12: 112,780,742 probably benign Het
Arsj T A 3: 126,438,337 V244E probably damaging Het
Atm T C 9: 53,507,881 E757G probably benign Het
AU040320 A G 4: 126,792,072 D147G probably benign Het
Btnl10 A T 11: 58,919,308 M92L possibly damaging Het
Chd6 T C 2: 160,950,063 D2458G probably damaging Het
Cntn3 T C 6: 102,273,811 I259V probably damaging Het
Ctns A G 11: 73,186,392 V250A probably benign Het
Cxxc1 T A 18: 74,220,607 probably null Het
Cyp2a4 A T 7: 26,312,307 M318L probably benign Het
Dchs1 A G 7: 105,763,185 L1302P probably damaging Het
Decr1 C A 4: 15,945,392 Het
Dmbx1 T C 4: 115,918,268 N272D probably damaging Het
Dsel C A 1: 111,862,847 probably benign Het
Dspp A C 5: 104,176,938 D389A possibly damaging Het
Ero1l T C 14: 45,306,592 T52A probably damaging Het
Fam186a T C 15: 99,941,676 E2229G unknown Het
Fam208a C T 14: 27,472,331 P1163S probably benign Het
Gpc2 A T 5: 138,278,910 F85Y probably damaging Het
Gucy2g A G 19: 55,210,332 L793S probably benign Het
Itpr3 G C 17: 27,089,295 G298R probably damaging Het
Kalrn A T 16: 34,217,891 C1024S probably damaging Het
Krt40 T C 11: 99,540,128 Y185C probably benign Het
Lmo7 G A 14: 101,884,179 D227N probably damaging Het
Mmrn1 T A 6: 60,988,540 L1184* probably null Het
Mrvi1 C G 7: 110,895,854 E455Q probably damaging Het
Olfr113 T A 17: 37,574,743 R227W probably damaging Het
Olfr1211 T A 2: 88,929,509 M269L probably benign Het
Olfr982 T A 9: 40,074,813 Y173N probably damaging Het
Parp9 T G 16: 35,953,672 V338G probably benign Het
Pcdh15 G A 10: 74,630,614 E888K possibly damaging Het
Pcdh9 C T 14: 93,886,149 E862K probably damaging Het
Prkdc A G 16: 15,790,453 T3040A probably benign Het
Qser1 T C 2: 104,787,119 E1026G probably damaging Het
Rnf20 C T 4: 49,644,580 R282* probably null Het
Rpgrip1l T A 8: 91,263,520 K765* probably null Het
Rprd2 G A 3: 95,765,016 T1025M probably damaging Het
Scn4a A G 11: 106,322,157 Y1341H possibly damaging Het
Scn5a C G 9: 119,489,911 D1554H probably damaging Het
Sept14 T C 5: 129,697,806 I102V probably benign Het
Sept4 A G 11: 87,590,367 T378A probably benign Het
Siglec1 C T 2: 131,083,914 G291R probably benign Het
Sik2 A G 9: 50,907,420 V418A probably damaging Het
Slc9a5 A G 8: 105,349,446 T24A possibly damaging Het
Spata31d1b T C 13: 59,716,141 S368P probably benign Het
Stip1 T C 19: 7,035,557 D53G probably benign Het
Stk36 T C 1: 74,610,820 W245R probably damaging Het
Stk39 A T 2: 68,358,812 probably null Het
Tacr2 T C 10: 62,261,497 M252T probably damaging Het
Terb1 A T 8: 104,488,554 N263K probably benign Het
Tgm5 T C 2: 121,053,514 M333V probably benign Het
Tmem45a T C 16: 56,822,404 M135V probably benign Het
Trmt13 T A 3: 116,582,697 K348N probably damaging Het
Trmt2a A T 16: 18,253,004 M534L probably damaging Het
Ttll13 G A 7: 80,257,030 R513K probably null Het
Vmn1r228 T A 17: 20,777,023 I78L probably benign Het
Washc3 T C 10: 88,245,773 V173A possibly damaging Het
Zc2hc1b A T 10: 13,171,305 C21S probably damaging Het
Zfp944 T A 17: 22,339,579 H229L probably damaging Het
Zfp985 T A 4: 147,583,116 I147N probably benign Het
Other mutations in Gabrd
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0006:Gabrd UTSW 4 155388601 missense probably damaging 1.00
R0006:Gabrd UTSW 4 155388601 missense probably damaging 1.00
R0569:Gabrd UTSW 4 155385423 missense probably damaging 1.00
R1826:Gabrd UTSW 4 155386486 missense probably damaging 1.00
R4387:Gabrd UTSW 4 155388932 critical splice donor site probably null
R5071:Gabrd UTSW 4 155387162 missense probably damaging 1.00
R5650:Gabrd UTSW 4 155388624 missense probably damaging 1.00
R5818:Gabrd UTSW 4 155388361 missense probably damaging 1.00
R6045:Gabrd UTSW 4 155386474 missense possibly damaging 0.82
R6301:Gabrd UTSW 4 155387267 missense probably damaging 0.96
R7146:Gabrd UTSW 4 155385406 missense probably benign
R7426:Gabrd UTSW 4 155385513 missense possibly damaging 0.81
R7451:Gabrd UTSW 4 155388459 missense possibly damaging 0.72
R7732:Gabrd UTSW 4 155385618 missense probably benign 0.00
R7784:Gabrd UTSW 4 155388932 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CACTGGCTACCATCATGTATCTG -3'
(R):5'- TCAATCGGCTCTCTGGGTTG -3'

Sequencing Primer
(F):5'- GCTACCATCATGTATCTGTGTGG -3'
(R):5'- CTCTCTGGGTTGTGTGCCATC -3'
Posted On2019-05-13