Incidental Mutation 'R7064:Scn4a'
ID548466
Institutional Source Beutler Lab
Gene Symbol Scn4a
Ensembl Gene ENSMUSG00000001027
Gene Namesodium channel, voltage-gated, type IV, alpha
SynonymsSkM1, mH2, Nav1.4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7064 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location106318592-106353288 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106322157 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1341 (Y1341H)
Ref Sequence ENSEMBL: ENSMUSP00000021056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021056]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021056
AA Change: Y1341H

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000021056
Gene: ENSMUSG00000001027
AA Change: Y1341H

DomainStartEndE-ValueType
Pfam:Ion_trans 130 452 1.1e-80 PFAM
low complexity region 473 491 N/A INTRINSIC
Pfam:Ion_trans 571 805 4.2e-56 PFAM
Pfam:Na_trans_assoc 810 1020 3.2e-59 PFAM
Pfam:Ion_trans 1024 1299 1.4e-64 PFAM
Pfam:Ion_trans 1346 1603 6.1e-55 PFAM
Pfam:PKD_channel 1441 1598 1.4e-6 PFAM
IQ 1720 1742 2.5e-2 SMART
low complexity region 1815 1827 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. It is expressed in skeletal muscle, and mutations in this gene have been linked to several myotonia and periodic paralysis disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous or homozygous for a knock-in allele develop myotonia, increased myofiber damage, K+-sensitive paralysis and susceptibility to delayed weakness during recovery from fatigue. Homozygotes show perinatal lethality, low survival rate, unusual hind-limb clasping and reduced body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T C 8: 60,531,712 I263T probably damaging Het
Adamtsl1 C T 4: 86,342,041 P830S possibly damaging Het
Adrb1 T C 19: 56,723,024 F218S probably damaging Het
Ahnak2 T C 12: 112,780,742 probably benign Het
Arsj T A 3: 126,438,337 V244E probably damaging Het
Atm T C 9: 53,507,881 E757G probably benign Het
AU040320 A G 4: 126,792,072 D147G probably benign Het
Btnl10 A T 11: 58,919,308 M92L possibly damaging Het
Chd6 T C 2: 160,950,063 D2458G probably damaging Het
Cntn3 T C 6: 102,273,811 I259V probably damaging Het
Ctns A G 11: 73,186,392 V250A probably benign Het
Cxxc1 T A 18: 74,220,607 probably null Het
Cyp2a4 A T 7: 26,312,307 M318L probably benign Het
Dchs1 A G 7: 105,763,185 L1302P probably damaging Het
Decr1 C A 4: 15,945,392 Het
Dmbx1 T C 4: 115,918,268 N272D probably damaging Het
Dsel C A 1: 111,862,847 probably benign Het
Dspp A C 5: 104,176,938 D389A possibly damaging Het
Ero1l T C 14: 45,306,592 T52A probably damaging Het
Fam186a T C 15: 99,941,676 E2229G unknown Het
Fam208a C T 14: 27,472,331 P1163S probably benign Het
Gabrd C T 4: 155,388,346 V127M probably damaging Het
Gpc2 A T 5: 138,278,910 F85Y probably damaging Het
Gucy2g A G 19: 55,210,332 L793S probably benign Het
Itpr3 G C 17: 27,089,295 G298R probably damaging Het
Kalrn A T 16: 34,217,891 C1024S probably damaging Het
Krt40 T C 11: 99,540,128 Y185C probably benign Het
Lmo7 G A 14: 101,884,179 D227N probably damaging Het
Mmrn1 T A 6: 60,988,540 L1184* probably null Het
Mrvi1 C G 7: 110,895,854 E455Q probably damaging Het
Olfr113 T A 17: 37,574,743 R227W probably damaging Het
Olfr1211 T A 2: 88,929,509 M269L probably benign Het
Olfr982 T A 9: 40,074,813 Y173N probably damaging Het
Parp9 T G 16: 35,953,672 V338G probably benign Het
Pcdh15 G A 10: 74,630,614 E888K possibly damaging Het
Pcdh9 C T 14: 93,886,149 E862K probably damaging Het
Prkdc A G 16: 15,790,453 T3040A probably benign Het
Qser1 T C 2: 104,787,119 E1026G probably damaging Het
Rnf20 C T 4: 49,644,580 R282* probably null Het
Rpgrip1l T A 8: 91,263,520 K765* probably null Het
Rprd2 G A 3: 95,765,016 T1025M probably damaging Het
Scn5a C G 9: 119,489,911 D1554H probably damaging Het
Sept14 T C 5: 129,697,806 I102V probably benign Het
Sept4 A G 11: 87,590,367 T378A probably benign Het
Siglec1 C T 2: 131,083,914 G291R probably benign Het
Sik2 A G 9: 50,907,420 V418A probably damaging Het
Slc9a5 A G 8: 105,349,446 T24A possibly damaging Het
Spata31d1b T C 13: 59,716,141 S368P probably benign Het
Stip1 T C 19: 7,035,557 D53G probably benign Het
Stk36 T C 1: 74,610,820 W245R probably damaging Het
Stk39 A T 2: 68,358,812 probably null Het
Tacr2 T C 10: 62,261,497 M252T probably damaging Het
Terb1 A T 8: 104,488,554 N263K probably benign Het
Tgm5 T C 2: 121,053,514 M333V probably benign Het
Tmem45a T C 16: 56,822,404 M135V probably benign Het
Trmt13 T A 3: 116,582,697 K348N probably damaging Het
Trmt2a A T 16: 18,253,004 M534L probably damaging Het
Ttll13 G A 7: 80,257,030 R513K probably null Het
Vmn1r228 T A 17: 20,777,023 I78L probably benign Het
Washc3 T C 10: 88,245,773 V173A possibly damaging Het
Zc2hc1b A T 10: 13,171,305 C21S probably damaging Het
Zfp944 T A 17: 22,339,579 H229L probably damaging Het
Zfp985 T A 4: 147,583,116 I147N probably benign Het
Other mutations in Scn4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Scn4a APN 11 106319919 missense probably benign
IGL00846:Scn4a APN 11 106328118 missense probably benign 0.03
IGL01063:Scn4a APN 11 106330364 missense possibly damaging 0.91
IGL01450:Scn4a APN 11 106324661 missense probably damaging 0.99
IGL01922:Scn4a APN 11 106339152 critical splice donor site probably null
IGL02589:Scn4a APN 11 106328132 missense probably benign 0.08
IGL03171:Scn4a APN 11 106345592 missense probably benign 0.01
IGL03338:Scn4a APN 11 106320845 missense probably damaging 1.00
BB004:Scn4a UTSW 11 106342383 missense probably damaging 1.00
BB014:Scn4a UTSW 11 106342383 missense probably damaging 1.00
R0013:Scn4a UTSW 11 106348405 splice site probably benign
R0013:Scn4a UTSW 11 106348405 splice site probably benign
R0025:Scn4a UTSW 11 106324560 missense probably benign 0.39
R0025:Scn4a UTSW 11 106324560 missense probably benign 0.39
R0050:Scn4a UTSW 11 106320856 missense probably damaging 1.00
R0113:Scn4a UTSW 11 106345436 missense probably benign 0.00
R0193:Scn4a UTSW 11 106320538 nonsense probably null
R0410:Scn4a UTSW 11 106323949 missense probably damaging 1.00
R0512:Scn4a UTSW 11 106345677 missense probably damaging 1.00
R0532:Scn4a UTSW 11 106330400 missense probably benign 0.45
R1112:Scn4a UTSW 11 106320466 missense probably damaging 1.00
R1279:Scn4a UTSW 11 106335682 missense probably damaging 1.00
R1564:Scn4a UTSW 11 106345541 missense probably benign
R1712:Scn4a UTSW 11 106339354 missense probably damaging 1.00
R1712:Scn4a UTSW 11 106345547 missense probably benign 0.20
R1721:Scn4a UTSW 11 106320820 missense probably benign 0.31
R1900:Scn4a UTSW 11 106327533 missense probably damaging 1.00
R2057:Scn4a UTSW 11 106335724 missense probably damaging 0.97
R2209:Scn4a UTSW 11 106339225 missense probably damaging 1.00
R3416:Scn4a UTSW 11 106330413 missense probably benign 0.00
R3788:Scn4a UTSW 11 106344274 missense probably damaging 0.96
R3853:Scn4a UTSW 11 106320106 missense possibly damaging 0.94
R3861:Scn4a UTSW 11 106326124 splice site probably benign
R3912:Scn4a UTSW 11 106320716 missense probably damaging 1.00
R3983:Scn4a UTSW 11 106347818 missense probably damaging 1.00
R4036:Scn4a UTSW 11 106322057 missense possibly damaging 0.75
R4358:Scn4a UTSW 11 106348857 splice site probably null
R4556:Scn4a UTSW 11 106320446 missense probably benign 0.32
R4677:Scn4a UTSW 11 106323962 missense probably damaging 1.00
R4863:Scn4a UTSW 11 106320002 missense probably damaging 1.00
R4924:Scn4a UTSW 11 106320088 missense possibly damaging 0.83
R5081:Scn4a UTSW 11 106348727 missense probably damaging 0.99
R5298:Scn4a UTSW 11 106339386 missense probably damaging 1.00
R5407:Scn4a UTSW 11 106320889 missense probably damaging 1.00
R5634:Scn4a UTSW 11 106330004 missense probably benign
R6381:Scn4a UTSW 11 106320311 missense probably damaging 1.00
R6468:Scn4a UTSW 11 106345676 missense probably damaging 1.00
R6489:Scn4a UTSW 11 106349180 missense probably benign 0.26
R6549:Scn4a UTSW 11 106343965 missense probably damaging 1.00
R6606:Scn4a UTSW 11 106328073 missense probably benign 0.39
R7037:Scn4a UTSW 11 106320900 missense probably damaging 0.98
R7182:Scn4a UTSW 11 106330308 missense probably benign 0.21
R7194:Scn4a UTSW 11 106324236 missense probably benign 0.32
R7531:Scn4a UTSW 11 106348697 splice site probably null
R7552:Scn4a UTSW 11 106349169 missense probably benign 0.22
R7570:Scn4a UTSW 11 106320473 missense possibly damaging 0.54
R7635:Scn4a UTSW 11 106324632 missense probably damaging 1.00
R7823:Scn4a UTSW 11 106342508 missense probably damaging 1.00
R7832:Scn4a UTSW 11 106322015 missense probably benign 0.01
R7927:Scn4a UTSW 11 106342383 missense probably damaging 1.00
R8122:Scn4a UTSW 11 106330331 missense probably benign 0.02
R8131:Scn4a UTSW 11 106341541 missense probably benign
X0012:Scn4a UTSW 11 106330061 missense probably damaging 1.00
X0065:Scn4a UTSW 11 106322178 missense probably damaging 0.98
Z1176:Scn4a UTSW 11 106321908 missense probably null 0.29
Z1176:Scn4a UTSW 11 106341529 missense probably benign 0.26
Z1176:Scn4a UTSW 11 106341530 missense probably damaging 0.97
Z1177:Scn4a UTSW 11 106330208 missense not run
Z1177:Scn4a UTSW 11 106341542 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCAAACATCTTGAGCACAC -3'
(R):5'- ACTGACGAATACACAGGGGC -3'

Sequencing Primer
(F):5'- CACTCCCCTGTGAAGACGATAATG -3'
(R):5'- GAGAGAGAACAATGTCTTCCCTTCTG -3'
Posted On2019-05-13