Incidental Mutation 'R7064:Fam208a'
ID548469
Institutional Source Beutler Lab
Gene Symbol Fam208a
Ensembl Gene ENSMUSG00000040651
Gene Namefamily with sequence similarity 208, member A
SynonymsD14Abb1e, 4933409E02Rik
MMRRC Submission
Accession Numbers

Ensembl: ENSMUST00000059031; MGI: 1921694

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7064 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location27428834-27483555 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 27472331 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 1163 (P1163S)
Ref Sequence ENSEMBL: ENSMUSP00000022450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022450]
Predicted Effect probably benign
Transcript: ENSMUST00000022450
AA Change: P1163S

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000022450
Gene: ENSMUSG00000040651
AA Change: P1163S

DomainStartEndE-ValueType
low complexity region 20 27 N/A INTRINSIC
low complexity region 42 61 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
Pfam:DUF3715 153 314 1.5e-55 PFAM
low complexity region 442 457 N/A INTRINSIC
low complexity region 1087 1102 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000225139
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for ENU mutations are not viable past gastrulation. [provided by MGI curators]
Allele List at MGI

All alleles(26) : Gene trapped(26)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T C 8: 60,531,712 I263T probably damaging Het
Adamtsl1 C T 4: 86,342,041 P830S possibly damaging Het
Adrb1 T C 19: 56,723,024 F218S probably damaging Het
Ahnak2 T C 12: 112,780,742 probably benign Het
Arsj T A 3: 126,438,337 V244E probably damaging Het
Atm T C 9: 53,507,881 E757G probably benign Het
AU040320 A G 4: 126,792,072 D147G probably benign Het
Btnl10 A T 11: 58,919,308 M92L possibly damaging Het
Chd6 T C 2: 160,950,063 D2458G probably damaging Het
Cntn3 T C 6: 102,273,811 I259V probably damaging Het
Ctns A G 11: 73,186,392 V250A probably benign Het
Cxxc1 T A 18: 74,220,607 probably null Het
Cyp2a4 A T 7: 26,312,307 M318L probably benign Het
Dchs1 A G 7: 105,763,185 L1302P probably damaging Het
Decr1 C A 4: 15,945,392 Het
Dmbx1 T C 4: 115,918,268 N272D probably damaging Het
Dsel C A 1: 111,862,847 probably benign Het
Dspp A C 5: 104,176,938 D389A possibly damaging Het
Ero1l T C 14: 45,306,592 T52A probably damaging Het
Fam186a T C 15: 99,941,676 E2229G unknown Het
Gabrd C T 4: 155,388,346 V127M probably damaging Het
Gpc2 A T 5: 138,278,910 F85Y probably damaging Het
Gucy2g A G 19: 55,210,332 L793S probably benign Het
Itpr3 G C 17: 27,089,295 G298R probably damaging Het
Kalrn A T 16: 34,217,891 C1024S probably damaging Het
Krt40 T C 11: 99,540,128 Y185C probably benign Het
Lmo7 G A 14: 101,884,179 D227N probably damaging Het
Mmrn1 T A 6: 60,988,540 L1184* probably null Het
Mrvi1 C G 7: 110,895,854 E455Q probably damaging Het
Olfr113 T A 17: 37,574,743 R227W probably damaging Het
Olfr1211 T A 2: 88,929,509 M269L probably benign Het
Olfr982 T A 9: 40,074,813 Y173N probably damaging Het
Parp9 T G 16: 35,953,672 V338G probably benign Het
Pcdh15 G A 10: 74,630,614 E888K possibly damaging Het
Pcdh9 C T 14: 93,886,149 E862K probably damaging Het
Prkdc A G 16: 15,790,453 T3040A probably benign Het
Qser1 T C 2: 104,787,119 E1026G probably damaging Het
Rnf20 C T 4: 49,644,580 R282* probably null Het
Rpgrip1l T A 8: 91,263,520 K765* probably null Het
Rprd2 G A 3: 95,765,016 T1025M probably damaging Het
Scn4a A G 11: 106,322,157 Y1341H possibly damaging Het
Scn5a C G 9: 119,489,911 D1554H probably damaging Het
Sept14 T C 5: 129,697,806 I102V probably benign Het
Sept4 A G 11: 87,590,367 T378A probably benign Het
Siglec1 C T 2: 131,083,914 G291R probably benign Het
Sik2 A G 9: 50,907,420 V418A probably damaging Het
Slc9a5 A G 8: 105,349,446 T24A possibly damaging Het
Spata31d1b T C 13: 59,716,141 S368P probably benign Het
Stip1 T C 19: 7,035,557 D53G probably benign Het
Stk36 T C 1: 74,610,820 W245R probably damaging Het
Stk39 A T 2: 68,358,812 probably null Het
Tacr2 T C 10: 62,261,497 M252T probably damaging Het
Terb1 A T 8: 104,488,554 N263K probably benign Het
Tgm5 T C 2: 121,053,514 M333V probably benign Het
Tmem45a T C 16: 56,822,404 M135V probably benign Het
Trmt13 T A 3: 116,582,697 K348N probably damaging Het
Trmt2a A T 16: 18,253,004 M534L probably damaging Het
Ttll13 G A 7: 80,257,030 R513K probably null Het
Vmn1r228 T A 17: 20,777,023 I78L probably benign Het
Washc3 T C 10: 88,245,773 V173A possibly damaging Het
Zc2hc1b A T 10: 13,171,305 C21S probably damaging Het
Zfp944 T A 17: 22,339,579 H229L probably damaging Het
Zfp985 T A 4: 147,583,116 I147N probably benign Het
Other mutations in Fam208a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Fam208a APN 14 27448206 missense probably damaging 1.00
IGL00467:Fam208a APN 14 27448164 missense probably benign 0.02
IGL01071:Fam208a APN 14 27442622 critical splice donor site probably null
IGL01351:Fam208a APN 14 27464301 missense probably benign 0.02
IGL01375:Fam208a APN 14 27440163 missense probably damaging 1.00
IGL01509:Fam208a APN 14 27459774 splice site probably benign
IGL02342:Fam208a APN 14 27476667 missense possibly damaging 0.83
IGL03105:Fam208a APN 14 27442552 missense probably damaging 0.98
IGL03131:Fam208a APN 14 27461179 nonsense probably null
IGL03248:Fam208a APN 14 27476692 missense probably damaging 1.00
IGL03383:Fam208a APN 14 27441961 missense possibly damaging 0.93
balsam UTSW 14 27461150 missense probably benign 0.01
santa_rosa UTSW 14 27476701 splice site probably null
D4043:Fam208a UTSW 14 27471992 missense probably benign 0.07
R0147:Fam208a UTSW 14 27471768 missense probably benign 0.23
R0512:Fam208a UTSW 14 27446406 missense probably damaging 1.00
R0589:Fam208a UTSW 14 27461150 missense probably benign 0.01
R0609:Fam208a UTSW 14 27461750 missense probably benign 0.09
R0798:Fam208a UTSW 14 27476636 missense probably damaging 1.00
R1107:Fam208a UTSW 14 27479723 nonsense probably null
R1205:Fam208a UTSW 14 27461318 missense probably damaging 1.00
R1376:Fam208a UTSW 14 27429381 missense probably benign 0.00
R1376:Fam208a UTSW 14 27429381 missense probably benign 0.00
R1441:Fam208a UTSW 14 27464260 nonsense probably null
R1493:Fam208a UTSW 14 27449969 missense probably damaging 1.00
R1527:Fam208a UTSW 14 27480093 critical splice donor site probably null
R1729:Fam208a UTSW 14 27479633 missense probably damaging 1.00
R1752:Fam208a UTSW 14 27471928 nonsense probably null
R1960:Fam208a UTSW 14 27438664 missense probably damaging 1.00
R1960:Fam208a UTSW 14 27479789 missense possibly damaging 0.95
R1965:Fam208a UTSW 14 27442554 missense probably damaging 1.00
R2074:Fam208a UTSW 14 27461213 missense probably benign 0.03
R2107:Fam208a UTSW 14 27461787 critical splice donor site probably null
R2130:Fam208a UTSW 14 27446388 missense probably damaging 1.00
R2130:Fam208a UTSW 14 27476614 missense possibly damaging 0.74
R2131:Fam208a UTSW 14 27476614 missense possibly damaging 0.74
R2133:Fam208a UTSW 14 27476614 missense possibly damaging 0.74
R2140:Fam208a UTSW 14 27480035 missense probably damaging 1.00
R2184:Fam208a UTSW 14 27466184 missense possibly damaging 0.83
R2279:Fam208a UTSW 14 27442495 missense probably damaging 1.00
R3979:Fam208a UTSW 14 27477130 missense possibly damaging 0.95
R4113:Fam208a UTSW 14 27459961 nonsense probably null
R4434:Fam208a UTSW 14 27449861 critical splice donor site probably null
R4562:Fam208a UTSW 14 27466308 missense possibly damaging 0.67
R4568:Fam208a UTSW 14 27476701 splice site probably null
R4754:Fam208a UTSW 14 27461095 missense probably benign
R4980:Fam208a UTSW 14 27461425 missense probably benign 0.39
R4993:Fam208a UTSW 14 27429114 missense possibly damaging 0.88
R5200:Fam208a UTSW 14 27429226 missense probably benign 0.41
R5316:Fam208a UTSW 14 27472035 missense possibly damaging 0.52
R5599:Fam208a UTSW 14 27479929 missense probably benign 0.01
R5678:Fam208a UTSW 14 27429123 small insertion probably benign
R5680:Fam208a UTSW 14 27429123 small insertion probably benign
R5887:Fam208a UTSW 14 27466297 nonsense probably null
R6181:Fam208a UTSW 14 27472278 missense probably benign 0.01
R6556:Fam208a UTSW 14 27429258 missense probably benign
R6603:Fam208a UTSW 14 27446386 missense probably damaging 1.00
R6829:Fam208a UTSW 14 27442481 missense possibly damaging 0.90
R6864:Fam208a UTSW 14 27461158 missense probably damaging 0.96
R6919:Fam208a UTSW 14 27449801 nonsense probably null
R7046:Fam208a UTSW 14 27472435 missense probably damaging 1.00
R7057:Fam208a UTSW 14 27461651 missense probably damaging 0.97
R7290:Fam208a UTSW 14 27438653 missense probably damaging 1.00
R7303:Fam208a UTSW 14 27471852 missense probably damaging 1.00
R7439:Fam208a UTSW 14 27471645 missense probably damaging 1.00
R7524:Fam208a UTSW 14 27466203 missense probably damaging 0.99
R7580:Fam208a UTSW 14 27466286 missense probably benign 0.29
R7726:Fam208a UTSW 14 27447497 missense probably damaging 0.99
R7771:Fam208a UTSW 14 27467559 missense probably damaging 1.00
R7782:Fam208a UTSW 14 27471944 missense probably benign 0.07
R7795:Fam208a UTSW 14 27481383 missense
R7835:Fam208a UTSW 14 27476643 missense probably damaging 1.00
R7954:Fam208a UTSW 14 27447524 critical splice donor site probably null
R7981:Fam208a UTSW 14 27446416 missense possibly damaging 0.49
R8101:Fam208a UTSW 14 27442481 missense possibly damaging 0.90
R8160:Fam208a UTSW 14 27449956 missense probably damaging 1.00
R8307:Fam208a UTSW 14 27471665 missense probably damaging 1.00
X0002:Fam208a UTSW 14 27472106 missense possibly damaging 0.90
Z1176:Fam208a UTSW 14 27429208 missense probably damaging 0.97
Z1176:Fam208a UTSW 14 27477148 missense probably damaging 1.00
Z1177:Fam208a UTSW 14 27448250 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCATTCCCATGCTGCAGC -3'
(R):5'- TTGCAAAGCACACTCTCCTC -3'

Sequencing Primer
(F):5'- CTTCTCTGGGAAGGCGTG -3'
(R):5'- TCCTCTTCTTCGTGAATGTAAAAC -3'
Posted On2019-05-13