Incidental Mutation 'R0612:Fgd2'
ID 54847
Institutional Source Beutler Lab
Gene Symbol Fgd2
Ensembl Gene ENSMUSG00000024013
Gene Name FYVE, RhoGEF and PH domain containing 2
Synonyms tcs2, Tcd-2, Tcd2, tcs-2
MMRRC Submission 038801-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.235) question?
Stock # R0612 (G1)
Quality Score 222
Status Validated
Chromosome 17
Chromosomal Location 29579878-29598509 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 29597321 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 547 (V547E)
Ref Sequence ENSEMBL: ENSMUSP00000024810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024810] [ENSMUST00000123989]
AlphaFold Q8BY35
Predicted Effect probably benign
Transcript: ENSMUST00000024810
AA Change: V547E

PolyPhen 2 Score 0.449 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000024810
Gene: ENSMUSG00000024013
AA Change: V547E

DomainStartEndE-ValueType
RhoGEF 106 289 4.49e-66 SMART
PH 320 420 2.09e-16 SMART
FYVE 450 519 1.07e-28 SMART
PH 545 643 5.09e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123989
SMART Domains Protein: ENSMUSP00000118828
Gene: ENSMUSG00000024013

DomainStartEndE-ValueType
RhoGEF 106 289 4.49e-66 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137644
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140918
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144616
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 93.5%
Validation Efficiency 98% (92/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of guanine nucleotide exchange factors (GEFs) which control cytoskeleton-dependent membrane rearrangements by activating the cell division cycle 42 (CDC42) protein. This gene is expressed in B lymphocytes, macrophages, and dendritic cells. The encoded protein may play a role in leukocyte signaling and vesicle trafficking in antigen-presenting cells in the immune system. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T C 7: 119,936,478 (GRCm39) L181P probably damaging Het
Aldh3a1 A T 11: 61,105,445 (GRCm39) I184F probably damaging Het
Arl6ip4 A G 5: 124,254,596 (GRCm39) S30G probably benign Het
Atp9b T C 18: 80,797,171 (GRCm39) E891G possibly damaging Het
Brsk1 T C 7: 4,710,425 (GRCm39) L478P possibly damaging Het
Btaf1 G A 19: 36,946,537 (GRCm39) V448I probably damaging Het
Cab39 T C 1: 85,746,236 (GRCm39) probably null Het
Cacna2d4 G T 6: 119,258,679 (GRCm39) probably benign Het
Capzb C T 4: 139,018,340 (GRCm39) S253L probably benign Het
Ccdc174 A G 6: 91,867,873 (GRCm39) probably benign Het
Ccdc180 C T 4: 45,927,969 (GRCm39) A1168V probably damaging Het
Cdh19 T C 1: 110,820,900 (GRCm39) probably benign Het
Cdh8 T C 8: 100,127,546 (GRCm39) T22A probably benign Het
Cdk10 T C 8: 123,957,419 (GRCm39) V181A probably benign Het
Ceacam15 A C 7: 16,407,445 (GRCm39) L24* probably null Het
Cftr A C 6: 18,198,125 (GRCm39) T20P probably benign Het
Cip2a C T 16: 48,819,402 (GRCm39) A112V probably benign Het
Clstn3 T C 6: 124,426,459 (GRCm39) T576A probably damaging Het
Col1a2 G A 6: 4,516,003 (GRCm39) V165I unknown Het
Copg2 A T 6: 30,838,404 (GRCm39) probably null Het
Cps1 A G 1: 67,178,929 (GRCm39) H47R probably benign Het
Cytip T C 2: 58,024,202 (GRCm39) D206G possibly damaging Het
Dcaf8l G A X: 88,448,972 (GRCm39) R386* probably null Het
Dnmt1 C T 9: 20,829,489 (GRCm39) E824K probably damaging Het
Dock7 A C 4: 98,877,470 (GRCm39) V442G probably benign Het
Dsc1 T G 18: 20,247,573 (GRCm39) K14T probably damaging Het
Dync1h1 C T 12: 110,582,930 (GRCm39) P371L probably damaging Het
Enah A G 1: 181,734,013 (GRCm39) probably benign Het
Entrep2 C T 7: 64,411,549 (GRCm39) V395M probably benign Het
Fastkd1 T C 2: 69,542,727 (GRCm39) T27A probably benign Het
Fcho1 A G 8: 72,168,168 (GRCm39) L248P probably damaging Het
Fezf1 A T 6: 23,247,028 (GRCm39) V268D probably damaging Het
Flnb T A 14: 7,887,682 (GRCm38) probably benign Het
Gabrg3 A G 7: 56,379,454 (GRCm39) M316T probably damaging Het
Gigyf2 T C 1: 87,376,802 (GRCm39) F1265L probably damaging Het
Git2 A G 5: 114,890,342 (GRCm39) S271P probably damaging Het
Gorab T C 1: 163,224,738 (GRCm39) D21G possibly damaging Het
Gpr179 T A 11: 97,229,264 (GRCm39) T964S possibly damaging Het
Hdac5 A G 11: 102,087,078 (GRCm39) V1042A possibly damaging Het
Hoxa2 T A 6: 52,140,540 (GRCm39) T149S probably damaging Het
Igsf8 G T 1: 172,146,974 (GRCm39) *108L probably null Het
Il1rap C T 16: 26,519,855 (GRCm39) T307M possibly damaging Het
Itih2 T C 2: 10,122,205 (GRCm39) D232G probably benign Het
Jak3 A G 8: 72,136,021 (GRCm39) Y607C probably damaging Het
Kcnh1 C T 1: 191,959,361 (GRCm39) P305L probably damaging Het
Lrrc7 T A 3: 157,869,990 (GRCm39) I644F probably damaging Het
Lrrn2 T C 1: 132,865,466 (GRCm39) L177P probably damaging Het
Lypd8l A G 11: 58,502,799 (GRCm39) probably null Het
Map4k3 C A 17: 80,909,622 (GRCm39) K712N probably damaging Het
Med11 A G 11: 70,342,910 (GRCm39) T36A probably benign Het
Mmp14 A G 14: 54,677,891 (GRCm39) D504G probably damaging Het
Mob1a A G 6: 83,311,140 (GRCm39) T120A probably benign Het
Mr1 T A 1: 155,013,436 (GRCm39) D47V probably damaging Het
Nacad G T 11: 6,551,382 (GRCm39) A603E possibly damaging Het
Nwd1 T A 8: 73,394,308 (GRCm39) W524R probably damaging Het
Or11g26 A T 14: 50,752,939 (GRCm39) T93S probably benign Het
Or13a19 T A 7: 139,903,101 (GRCm39) M163K possibly damaging Het
Or4e1 T C 14: 52,701,008 (GRCm39) T153A probably benign Het
Parp14 G A 16: 35,677,130 (GRCm39) A946V probably benign Het
Pde6c T A 19: 38,121,694 (GRCm39) C101S probably benign Het
Pdia3 G A 2: 121,262,858 (GRCm39) G275S probably damaging Het
Pdlim4 G A 11: 53,959,713 (GRCm39) R16C probably damaging Het
Pfkp A G 13: 6,655,670 (GRCm39) probably null Het
Plcg2 T A 8: 118,300,104 (GRCm39) S225T probably benign Het
Pramel1 T C 4: 143,124,101 (GRCm39) S259P probably damaging Het
Pramel27 G T 4: 143,578,658 (GRCm39) probably benign Het
Rc3h2 T C 2: 37,301,227 (GRCm39) N92D possibly damaging Het
Ric8b C A 10: 84,837,745 (GRCm39) N517K probably damaging Het
Rnf34 G A 5: 123,002,237 (GRCm39) R65H probably damaging Het
Rraga C T 4: 86,494,564 (GRCm39) R137C probably damaging Het
Scube2 C T 7: 109,403,971 (GRCm39) probably benign Het
Slc28a2b T C 2: 122,352,179 (GRCm39) M339T probably damaging Het
Spata31d1d T C 13: 59,875,787 (GRCm39) I583V probably benign Het
Suox T C 10: 128,506,525 (GRCm39) E501G probably benign Het
Susd1 A G 4: 59,390,561 (GRCm39) probably benign Het
Tac1 T C 6: 7,555,653 (GRCm39) S14P probably damaging Het
Tbc1d8 T C 1: 39,411,596 (GRCm39) E1080G possibly damaging Het
Tll1 A C 8: 64,524,344 (GRCm39) S447R possibly damaging Het
Tmem132e G A 11: 82,334,198 (GRCm39) V662M probably damaging Het
Upf2 G T 2: 6,038,909 (GRCm39) probably benign Het
Uspl1 A G 5: 149,151,767 (GRCm39) E989G probably damaging Het
Vmn1r58 T C 7: 5,413,618 (GRCm39) H204R probably damaging Het
Vmn2r25 A T 6: 123,816,481 (GRCm39) C367S probably damaging Het
Vps13b A T 15: 35,623,803 (GRCm39) Q1240L probably benign Het
Xrcc1 C T 7: 24,269,744 (GRCm39) probably benign Het
Yeats2 T G 16: 20,005,175 (GRCm39) V385G probably benign Het
Other mutations in Fgd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01397:Fgd2 APN 17 29,586,949 (GRCm39) missense probably damaging 1.00
IGL01505:Fgd2 APN 17 29,585,971 (GRCm39) missense probably damaging 1.00
IGL03240:Fgd2 APN 17 29,580,135 (GRCm39) splice site probably benign
ceci UTSW 17 29,587,350 (GRCm39) splice site probably null
R0046:Fgd2 UTSW 17 29,593,964 (GRCm39) splice site probably benign
R0271:Fgd2 UTSW 17 29,585,982 (GRCm39) missense possibly damaging 0.94
R0594:Fgd2 UTSW 17 29,584,526 (GRCm39) missense probably damaging 1.00
R1470:Fgd2 UTSW 17 29,593,082 (GRCm39) splice site probably benign
R1551:Fgd2 UTSW 17 29,597,383 (GRCm39) missense probably damaging 1.00
R1596:Fgd2 UTSW 17 29,595,904 (GRCm39) missense probably benign 0.43
R1664:Fgd2 UTSW 17 29,588,273 (GRCm39) missense probably damaging 1.00
R1689:Fgd2 UTSW 17 29,582,696 (GRCm39) missense probably benign
R1691:Fgd2 UTSW 17 29,597,918 (GRCm39) nonsense probably null
R1695:Fgd2 UTSW 17 29,587,219 (GRCm39) missense possibly damaging 0.88
R2697:Fgd2 UTSW 17 29,595,895 (GRCm39) missense probably damaging 1.00
R3500:Fgd2 UTSW 17 29,584,575 (GRCm39) missense possibly damaging 0.74
R3689:Fgd2 UTSW 17 29,597,924 (GRCm39) missense probably benign 0.00
R4583:Fgd2 UTSW 17 29,586,052 (GRCm39) missense possibly damaging 0.87
R4871:Fgd2 UTSW 17 29,592,223 (GRCm39) missense possibly damaging 0.89
R5011:Fgd2 UTSW 17 29,593,954 (GRCm39) critical splice donor site probably null
R5209:Fgd2 UTSW 17 29,587,350 (GRCm39) splice site probably null
R7106:Fgd2 UTSW 17 29,595,944 (GRCm39) nonsense probably null
R7139:Fgd2 UTSW 17 29,592,229 (GRCm39) missense probably damaging 1.00
R7712:Fgd2 UTSW 17 29,595,886 (GRCm39) missense probably benign 0.01
R7833:Fgd2 UTSW 17 29,586,369 (GRCm39) missense possibly damaging 0.81
R7834:Fgd2 UTSW 17 29,583,925 (GRCm39) missense probably damaging 1.00
R7913:Fgd2 UTSW 17 29,593,019 (GRCm39) missense probably damaging 1.00
R8547:Fgd2 UTSW 17 29,583,934 (GRCm39) missense probably damaging 0.99
R8686:Fgd2 UTSW 17 29,597,997 (GRCm39) missense probably benign
R9088:Fgd2 UTSW 17 29,583,913 (GRCm39) missense probably damaging 1.00
R9525:Fgd2 UTSW 17 29,583,955 (GRCm39) missense probably damaging 1.00
R9601:Fgd2 UTSW 17 29,593,860 (GRCm39) missense probably benign 0.09
Z1177:Fgd2 UTSW 17 29,597,300 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCTGAGCCTCTGAAACAAATGACCTG -3'
(R):5'- TTAGTCCTGCTGCTCCTGACAGAC -3'

Sequencing Primer
(F):5'- ggggtgtggggaaggtg -3'
(R):5'- gagggggaggggggaag -3'
Posted On 2013-07-11