Incidental Mutation 'R0612:Fgd2'
ID 54847
Institutional Source Beutler Lab
Gene Symbol Fgd2
Ensembl Gene ENSMUSG00000024013
Gene Name FYVE, RhoGEF and PH domain containing 2
Synonyms Tcd-2, tcs2, Tcd2, tcs-2
MMRRC Submission 038801-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.342) question?
Stock # R0612 (G1)
Quality Score 222
Status Validated
Chromosome 17
Chromosomal Location 29360914-29379660 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 29378347 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 547 (V547E)
Ref Sequence ENSEMBL: ENSMUSP00000024810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024810] [ENSMUST00000123989]
AlphaFold Q8BY35
Predicted Effect probably benign
Transcript: ENSMUST00000024810
AA Change: V547E

PolyPhen 2 Score 0.449 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000024810
Gene: ENSMUSG00000024013
AA Change: V547E

DomainStartEndE-ValueType
RhoGEF 106 289 4.49e-66 SMART
PH 320 420 2.09e-16 SMART
FYVE 450 519 1.07e-28 SMART
PH 545 643 5.09e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123989
SMART Domains Protein: ENSMUSP00000118828
Gene: ENSMUSG00000024013

DomainStartEndE-ValueType
RhoGEF 106 289 4.49e-66 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137644
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140918
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144616
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 93.5%
Validation Efficiency 98% (92/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of guanine nucleotide exchange factors (GEFs) which control cytoskeleton-dependent membrane rearrangements by activating the cell division cycle 42 (CDC42) protein. This gene is expressed in B lymphocytes, macrophages, and dendritic cells. The encoded protein may play a role in leukocyte signaling and vesicle trafficking in antigen-presenting cells in the immune system. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik A G 11: 58,611,973 probably null Het
Abca15 T C 7: 120,337,255 L181P probably damaging Het
Aldh3a1 A T 11: 61,214,619 I184F probably damaging Het
Arl6ip4 A G 5: 124,116,533 S30G probably benign Het
Atp9b T C 18: 80,753,956 E891G possibly damaging Het
Brsk1 T C 7: 4,707,426 L478P possibly damaging Het
Btaf1 G A 19: 36,969,137 V448I probably damaging Het
C330027C09Rik C T 16: 48,999,039 A112V probably benign Het
Cab39 T C 1: 85,818,515 probably null Het
Cacna2d4 G T 6: 119,281,718 probably benign Het
Capzb C T 4: 139,291,029 S253L probably benign Het
Ccdc174 A G 6: 91,890,892 probably benign Het
Ccdc180 C T 4: 45,927,969 A1168V probably damaging Het
Cdh19 T C 1: 110,893,170 probably benign Het
Cdh8 T C 8: 99,400,914 T22A probably benign Het
Cdk10 T C 8: 123,230,680 V181A probably benign Het
Ceacam15 A C 7: 16,673,520 L24* probably null Het
Cftr A C 6: 18,198,126 T20P probably benign Het
Clstn3 T C 6: 124,449,500 T576A probably damaging Het
Col1a2 G A 6: 4,516,003 V165I unknown Het
Copg2 A T 6: 30,861,469 probably null Het
Cps1 A G 1: 67,139,770 H47R probably benign Het
Cytip T C 2: 58,134,190 D206G possibly damaging Het
Dnmt1 C T 9: 20,918,193 E824K probably damaging Het
Dock7 A C 4: 98,989,233 V442G probably benign Het
Dsc1 T G 18: 20,114,516 K14T probably damaging Het
Dync1h1 C T 12: 110,616,496 P371L probably damaging Het
Enah A G 1: 181,906,448 probably benign Het
Fam189a1 C T 7: 64,761,801 V395M probably benign Het
Fastkd1 T C 2: 69,712,383 T27A probably benign Het
Fcho1 A G 8: 71,715,524 L248P probably damaging Het
Fezf1 A T 6: 23,247,029 V268D probably damaging Het
Flnb T A 14: 7,887,682 probably benign Het
Gabrg3 A G 7: 56,729,706 M316T probably damaging Het
Gigyf2 T C 1: 87,449,080 F1265L probably damaging Het
Git2 A G 5: 114,752,281 S271P probably damaging Het
Gm13103 G T 4: 143,852,088 probably benign Het
Gm14085 T C 2: 122,521,698 M339T probably damaging Het
Gorab T C 1: 163,397,169 D21G possibly damaging Het
Gpr179 T A 11: 97,338,438 T964S possibly damaging Het
Hdac5 A G 11: 102,196,252 V1042A possibly damaging Het
Hoxa2 T A 6: 52,163,560 T149S probably damaging Het
Igsf8 G T 1: 172,319,407 *108L probably null Het
Il1rap C T 16: 26,701,105 T307M possibly damaging Het
Itih2 T C 2: 10,117,394 D232G probably benign Het
Jak3 A G 8: 71,683,377 Y607C probably damaging Het
Kcnh1 C T 1: 192,277,053 P305L probably damaging Het
Lrrc7 T A 3: 158,164,353 I644F probably damaging Het
Lrrn2 T C 1: 132,937,728 L177P probably damaging Het
Map4k3 C A 17: 80,602,193 K712N probably damaging Het
Med11 A G 11: 70,452,084 T36A probably benign Het
Mmp14 A G 14: 54,440,434 D504G probably damaging Het
Mob1a A G 6: 83,334,158 T120A probably benign Het
Mr1 T A 1: 155,137,690 D47V probably damaging Het
Nacad G T 11: 6,601,382 A603E possibly damaging Het
Nwd1 T A 8: 72,667,680 W524R probably damaging Het
Olfr1508 T C 14: 52,463,551 T153A probably benign Het
Olfr525 T A 7: 140,323,188 M163K possibly damaging Het
Olfr742 A T 14: 50,515,482 T93S probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pde6c T A 19: 38,133,246 C101S probably benign Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Pdlim4 G A 11: 54,068,887 R16C probably damaging Het
Pet2 G A X: 89,405,366 R386* probably null Het
Pfkp A G 13: 6,605,634 probably null Het
Plcg2 T A 8: 117,573,365 S225T probably benign Het
Pramel1 T C 4: 143,397,531 S259P probably damaging Het
Rc3h2 T C 2: 37,411,215 N92D possibly damaging Het
Ric8b C A 10: 85,001,881 N517K probably damaging Het
Rnf34 G A 5: 122,864,174 R65H probably damaging Het
Rraga C T 4: 86,576,327 R137C probably damaging Het
Scube2 C T 7: 109,804,764 probably benign Het
Spata31d1d T C 13: 59,727,973 I583V probably benign Het
Suox T C 10: 128,670,656 E501G probably benign Het
Susd1 A G 4: 59,390,561 probably benign Het
Tac1 T C 6: 7,555,653 S14P probably damaging Het
Tbc1d8 T C 1: 39,372,515 E1080G possibly damaging Het
Tll1 A C 8: 64,071,310 S447R possibly damaging Het
Tmem132e G A 11: 82,443,372 V662M probably damaging Het
Upf2 G T 2: 6,034,098 probably benign Het
Uspl1 A G 5: 149,214,957 E989G probably damaging Het
Vmn1r58 T C 7: 5,410,619 H204R probably damaging Het
Vmn2r25 A T 6: 123,839,522 C367S probably damaging Het
Vps13b A T 15: 35,623,657 Q1240L probably benign Het
Xrcc1 C T 7: 24,570,319 probably benign Het
Yeats2 T G 16: 20,186,425 V385G probably benign Het
Other mutations in Fgd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01397:Fgd2 APN 17 29367975 missense probably damaging 1.00
IGL01505:Fgd2 APN 17 29366997 missense probably damaging 1.00
IGL03240:Fgd2 APN 17 29361161 splice site probably benign
ceci UTSW 17 29368376 splice site probably null
R0046:Fgd2 UTSW 17 29374990 splice site probably benign
R0271:Fgd2 UTSW 17 29367008 missense possibly damaging 0.94
R0594:Fgd2 UTSW 17 29365552 missense probably damaging 1.00
R1470:Fgd2 UTSW 17 29374108 splice site probably benign
R1551:Fgd2 UTSW 17 29378409 missense probably damaging 1.00
R1596:Fgd2 UTSW 17 29376930 missense probably benign 0.43
R1664:Fgd2 UTSW 17 29369299 missense probably damaging 1.00
R1689:Fgd2 UTSW 17 29363722 missense probably benign
R1691:Fgd2 UTSW 17 29378944 nonsense probably null
R1695:Fgd2 UTSW 17 29368245 missense possibly damaging 0.88
R2697:Fgd2 UTSW 17 29376921 missense probably damaging 1.00
R3500:Fgd2 UTSW 17 29365601 missense possibly damaging 0.74
R3689:Fgd2 UTSW 17 29378950 missense probably benign 0.00
R4583:Fgd2 UTSW 17 29367078 missense possibly damaging 0.87
R4871:Fgd2 UTSW 17 29373249 missense possibly damaging 0.89
R5011:Fgd2 UTSW 17 29374980 critical splice donor site probably null
R5209:Fgd2 UTSW 17 29368376 splice site probably null
R7106:Fgd2 UTSW 17 29376970 nonsense probably null
R7139:Fgd2 UTSW 17 29373255 missense probably damaging 1.00
R7712:Fgd2 UTSW 17 29376912 missense probably benign 0.01
R7833:Fgd2 UTSW 17 29367395 missense possibly damaging 0.81
R7834:Fgd2 UTSW 17 29364951 missense probably damaging 1.00
R7913:Fgd2 UTSW 17 29374045 missense probably damaging 1.00
R8547:Fgd2 UTSW 17 29364960 missense probably damaging 0.99
R8686:Fgd2 UTSW 17 29379023 missense probably benign
R9088:Fgd2 UTSW 17 29364939 missense probably damaging 1.00
R9525:Fgd2 UTSW 17 29364981 missense probably damaging 1.00
Z1177:Fgd2 UTSW 17 29378326 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCTGAGCCTCTGAAACAAATGACCTG -3'
(R):5'- TTAGTCCTGCTGCTCCTGACAGAC -3'

Sequencing Primer
(F):5'- ggggtgtggggaaggtg -3'
(R):5'- gagggggaggggggaag -3'
Posted On 2013-07-11