Incidental Mutation 'R7064:Lmo7'
ID548472
Institutional Source Beutler Lab
Gene Symbol Lmo7
Ensembl Gene ENSMUSG00000033060
Gene NameLIM domain only 7
SynonymsFBXO20, LOC380928
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock #R7064 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location101729957-101934710 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 101884179 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 227 (D227N)
Ref Sequence ENSEMBL: ENSMUSP00000097910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100337] [ENSMUST00000159026] [ENSMUST00000159258] [ENSMUST00000159314] [ENSMUST00000159597]
Predicted Effect probably damaging
Transcript: ENSMUST00000100337
AA Change: D227N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097910
Gene: ENSMUSG00000033060
AA Change: D227N

DomainStartEndE-ValueType
CH 14 124 2.57e-13 SMART
low complexity region 200 211 N/A INTRINSIC
Pfam:DUF4757 242 348 2.2e-14 PFAM
low complexity region 448 462 N/A INTRINSIC
Pfam:DUF4757 568 735 1.8e-46 PFAM
low complexity region 861 879 N/A INTRINSIC
low complexity region 979 991 N/A INTRINSIC
low complexity region 1003 1015 N/A INTRINSIC
PDZ 1047 1119 1.05e-8 SMART
coiled coil region 1222 1275 N/A INTRINSIC
coiled coil region 1319 1411 N/A INTRINSIC
low complexity region 1585 1596 N/A INTRINSIC
low complexity region 1599 1617 N/A INTRINSIC
LIM 1629 1687 6.54e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159026
SMART Domains Protein: ENSMUSP00000124605
Gene: ENSMUSG00000033060

DomainStartEndE-ValueType
low complexity region 215 229 N/A INTRINSIC
coiled coil region 435 471 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159258
SMART Domains Protein: ENSMUSP00000125465
Gene: ENSMUSG00000033060

DomainStartEndE-ValueType
low complexity region 215 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159314
SMART Domains Protein: ENSMUSP00000124349
Gene: ENSMUSG00000033060

DomainStartEndE-ValueType
low complexity region 215 229 N/A INTRINSIC
coiled coil region 435 492 N/A INTRINSIC
low complexity region 628 646 N/A INTRINSIC
low complexity region 746 758 N/A INTRINSIC
low complexity region 770 782 N/A INTRINSIC
PDZ 814 886 1.05e-8 SMART
coiled coil region 989 1042 N/A INTRINSIC
coiled coil region 1086 1178 N/A INTRINSIC
low complexity region 1352 1363 N/A INTRINSIC
low complexity region 1366 1384 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159597
AA Change: D105N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123706
Gene: ENSMUSG00000033060
AA Change: D105N

DomainStartEndE-ValueType
low complexity region 78 89 N/A INTRINSIC
internal_repeat_1 111 141 6.96e-5 PROSPERO
internal_repeat_1 218 248 6.96e-5 PROSPERO
low complexity region 326 340 N/A INTRINSIC
coiled coil region 546 603 N/A INTRINSIC
low complexity region 739 757 N/A INTRINSIC
low complexity region 857 869 N/A INTRINSIC
low complexity region 881 893 N/A INTRINSIC
PDZ 925 997 1.05e-8 SMART
coiled coil region 1127 1180 N/A INTRINSIC
coiled coil region 1224 1316 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1504 1522 N/A INTRINSIC
LIM 1534 1592 6.54e-10 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000124300
Gene: ENSMUSG00000033060
AA Change: D60N

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
Pfam:DUF4757 76 225 4.5e-53 PFAM
low complexity region 351 369 N/A INTRINSIC
low complexity region 469 481 N/A INTRINSIC
low complexity region 493 505 N/A INTRINSIC
PDZ 537 609 1.05e-8 SMART
internal_repeat_1 620 691 9.31e-5 PROSPERO
coiled coil region 711 764 N/A INTRINSIC
coiled coil region 808 900 N/A INTRINSIC
internal_repeat_1 921 976 9.31e-5 PROSPERO
low complexity region 1075 1086 N/A INTRINSIC
low complexity region 1089 1107 N/A INTRINSIC
LIM 1119 1177 6.54e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a calponin homology (CH) domain, a PDZ domain, and a LIM domain, and may be involved in protein-protein interactions. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene, however, the full-length nature of some variants is not known. [provided by RefSeq, Jan 2009]
PHENOTYPE: Targeted mutations in this gene result in postnatal lethality, growth defects, skeletal muscle abnormalities and retinal defects reflective of retinal degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T C 8: 60,531,712 I263T probably damaging Het
Adamtsl1 C T 4: 86,342,041 P830S possibly damaging Het
Adrb1 T C 19: 56,723,024 F218S probably damaging Het
Ahnak2 T C 12: 112,780,742 probably benign Het
Arsj T A 3: 126,438,337 V244E probably damaging Het
Atm T C 9: 53,507,881 E757G probably benign Het
AU040320 A G 4: 126,792,072 D147G probably benign Het
Btnl10 A T 11: 58,919,308 M92L possibly damaging Het
Chd6 T C 2: 160,950,063 D2458G probably damaging Het
Cntn3 T C 6: 102,273,811 I259V probably damaging Het
Ctns A G 11: 73,186,392 V250A probably benign Het
Cxxc1 T A 18: 74,220,607 probably null Het
Cyp2a4 A T 7: 26,312,307 M318L probably benign Het
Dchs1 A G 7: 105,763,185 L1302P probably damaging Het
Decr1 C A 4: 15,945,392 Het
Dmbx1 T C 4: 115,918,268 N272D probably damaging Het
Dsel C A 1: 111,862,847 probably benign Het
Dspp A C 5: 104,176,938 D389A possibly damaging Het
Ero1l T C 14: 45,306,592 T52A probably damaging Het
Fam186a T C 15: 99,941,676 E2229G unknown Het
Fam208a C T 14: 27,472,331 P1163S probably benign Het
Gabrd C T 4: 155,388,346 V127M probably damaging Het
Gpc2 A T 5: 138,278,910 F85Y probably damaging Het
Gucy2g A G 19: 55,210,332 L793S probably benign Het
Itpr3 G C 17: 27,089,295 G298R probably damaging Het
Kalrn A T 16: 34,217,891 C1024S probably damaging Het
Krt40 T C 11: 99,540,128 Y185C probably benign Het
Mmrn1 T A 6: 60,988,540 L1184* probably null Het
Mrvi1 C G 7: 110,895,854 E455Q probably damaging Het
Olfr113 T A 17: 37,574,743 R227W probably damaging Het
Olfr1211 T A 2: 88,929,509 M269L probably benign Het
Olfr982 T A 9: 40,074,813 Y173N probably damaging Het
Parp9 T G 16: 35,953,672 V338G probably benign Het
Pcdh15 G A 10: 74,630,614 E888K possibly damaging Het
Pcdh9 C T 14: 93,886,149 E862K probably damaging Het
Prkdc A G 16: 15,790,453 T3040A probably benign Het
Qser1 T C 2: 104,787,119 E1026G probably damaging Het
Rnf20 C T 4: 49,644,580 R282* probably null Het
Rpgrip1l T A 8: 91,263,520 K765* probably null Het
Rprd2 G A 3: 95,765,016 T1025M probably damaging Het
Scn4a A G 11: 106,322,157 Y1341H possibly damaging Het
Scn5a C G 9: 119,489,911 D1554H probably damaging Het
Sept14 T C 5: 129,697,806 I102V probably benign Het
Sept4 A G 11: 87,590,367 T378A probably benign Het
Siglec1 C T 2: 131,083,914 G291R probably benign Het
Sik2 A G 9: 50,907,420 V418A probably damaging Het
Slc9a5 A G 8: 105,349,446 T24A possibly damaging Het
Spata31d1b T C 13: 59,716,141 S368P probably benign Het
Stip1 T C 19: 7,035,557 D53G probably benign Het
Stk36 T C 1: 74,610,820 W245R probably damaging Het
Stk39 A T 2: 68,358,812 probably null Het
Tacr2 T C 10: 62,261,497 M252T probably damaging Het
Terb1 A T 8: 104,488,554 N263K probably benign Het
Tgm5 T C 2: 121,053,514 M333V probably benign Het
Tmem45a T C 16: 56,822,404 M135V probably benign Het
Trmt13 T A 3: 116,582,697 K348N probably damaging Het
Trmt2a A T 16: 18,253,004 M534L probably damaging Het
Ttll13 G A 7: 80,257,030 R513K probably null Het
Vmn1r228 T A 17: 20,777,023 I78L probably benign Het
Washc3 T C 10: 88,245,773 V173A possibly damaging Het
Zc2hc1b A T 10: 13,171,305 C21S probably damaging Het
Zfp944 T A 17: 22,339,579 H229L probably damaging Het
Zfp985 T A 4: 147,583,116 I147N probably benign Het
Other mutations in Lmo7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Lmo7 APN 14 101887051 missense probably damaging 0.99
IGL00733:Lmo7 APN 14 101915702 missense probably damaging 1.00
IGL00778:Lmo7 APN 14 101910885 splice site probably benign
IGL01014:Lmo7 APN 14 101920557 splice site probably benign
IGL01401:Lmo7 APN 14 101794277 nonsense probably null
IGL01550:Lmo7 APN 14 101926140 utr 3 prime probably benign
IGL01570:Lmo7 APN 14 101902371 critical splice donor site probably null
IGL01602:Lmo7 APN 14 101910756 splice site probably benign
IGL01605:Lmo7 APN 14 101910756 splice site probably benign
IGL02012:Lmo7 APN 14 101888716 intron probably benign
IGL02145:Lmo7 APN 14 101902223 missense probably benign 0.00
IGL02236:Lmo7 APN 14 101926088 splice site probably benign
IGL02318:Lmo7 APN 14 101900066 splice site probably benign
IGL02345:Lmo7 APN 14 101887473 missense probably damaging 1.00
IGL02498:Lmo7 APN 14 101807482 missense probably benign 0.01
IGL02583:Lmo7 APN 14 101933924 utr 3 prime probably benign
IGL02670:Lmo7 APN 14 101880980 missense probably damaging 1.00
IGL02694:Lmo7 APN 14 101887170 missense probably damaging 1.00
IGL03026:Lmo7 APN 14 101929333 utr 3 prime probably benign
IGL03062:Lmo7 APN 14 101912079 missense possibly damaging 0.66
IGL03068:Lmo7 APN 14 101875492 unclassified probably benign
IGL03178:Lmo7 APN 14 101929260 nonsense probably null
IGL03279:Lmo7 APN 14 101900508 missense probably benign 0.30
PIT4458001:Lmo7 UTSW 14 101887487 nonsense probably null
R0029:Lmo7 UTSW 14 101933921 utr 3 prime probably benign
R0112:Lmo7 UTSW 14 101887193 nonsense probably null
R0345:Lmo7 UTSW 14 101876877 missense probably damaging 1.00
R0372:Lmo7 UTSW 14 101918053 splice site probably benign
R0393:Lmo7 UTSW 14 101900456 missense probably benign
R0514:Lmo7 UTSW 14 101887173 missense probably damaging 1.00
R0514:Lmo7 UTSW 14 101896559 missense probably damaging 1.00
R0526:Lmo7 UTSW 14 101900560 missense probably damaging 1.00
R0615:Lmo7 UTSW 14 101876859 nonsense probably null
R0900:Lmo7 UTSW 14 101887188 missense probably damaging 1.00
R0961:Lmo7 UTSW 14 101794269 missense probably benign 0.00
R0964:Lmo7 UTSW 14 101920567 splice site probably benign
R1078:Lmo7 UTSW 14 101920474 splice site probably benign
R1252:Lmo7 UTSW 14 101900583 missense probably damaging 1.00
R1527:Lmo7 UTSW 14 101876828 missense probably damaging 1.00
R1537:Lmo7 UTSW 14 101929264 utr 3 prime probably benign
R1565:Lmo7 UTSW 14 101887521 missense probably damaging 0.99
R1637:Lmo7 UTSW 14 101880832 missense probably damaging 1.00
R1943:Lmo7 UTSW 14 101902302 missense probably damaging 1.00
R1967:Lmo7 UTSW 14 101900215 missense probably benign 0.36
R2002:Lmo7 UTSW 14 101887061 missense probably benign 0.13
R2057:Lmo7 UTSW 14 101887178 missense probably damaging 1.00
R2131:Lmo7 UTSW 14 101900238 missense probably damaging 0.99
R2153:Lmo7 UTSW 14 101920515 utr 3 prime probably benign
R2257:Lmo7 UTSW 14 101900130 missense probably damaging 1.00
R2355:Lmo7 UTSW 14 101888685 missense probably damaging 1.00
R2356:Lmo7 UTSW 14 101886945 missense probably damaging 1.00
R2898:Lmo7 UTSW 14 101876914 missense possibly damaging 0.93
R3847:Lmo7 UTSW 14 101922095 critical splice acceptor site probably null
R3848:Lmo7 UTSW 14 101922095 critical splice acceptor site probably null
R3849:Lmo7 UTSW 14 101922095 critical splice acceptor site probably null
R3916:Lmo7 UTSW 14 101929342 utr 3 prime probably benign
R4050:Lmo7 UTSW 14 101902277 nonsense probably null
R4326:Lmo7 UTSW 14 101900074 missense possibly damaging 0.93
R4357:Lmo7 UTSW 14 101887655 missense probably null 1.00
R4571:Lmo7 UTSW 14 101887594 missense probably damaging 0.96
R4658:Lmo7 UTSW 14 101886957 missense probably damaging 1.00
R4857:Lmo7 UTSW 14 101887348 intron probably null
R5006:Lmo7 UTSW 14 101926237 utr 3 prime probably benign
R5528:Lmo7 UTSW 14 101902086 missense probably damaging 1.00
R5588:Lmo7 UTSW 14 101896590 splice site probably null
R5643:Lmo7 UTSW 14 101929336 utr 3 prime probably benign
R5644:Lmo7 UTSW 14 101929336 utr 3 prime probably benign
R5650:Lmo7 UTSW 14 101898674 missense probably damaging 1.00
R5737:Lmo7 UTSW 14 101887236 missense probably damaging 1.00
R5832:Lmo7 UTSW 14 101884213 missense probably damaging 1.00
R5966:Lmo7 UTSW 14 101900502 missense possibly damaging 0.92
R6026:Lmo7 UTSW 14 101880990 missense probably benign 0.04
R6072:Lmo7 UTSW 14 101929336 utr 3 prime probably benign
R6158:Lmo7 UTSW 14 101900137 missense probably benign 0.03
R6246:Lmo7 UTSW 14 101918700 missense probably damaging 1.00
R6335:Lmo7 UTSW 14 101900636 missense probably damaging 1.00
R6620:Lmo7 UTSW 14 101875452 missense probably benign 0.29
R6658:Lmo7 UTSW 14 101910845 missense possibly damaging 0.84
R6917:Lmo7 UTSW 14 101918010 missense probably damaging 1.00
R7072:Lmo7 UTSW 14 101898700 critical splice donor site probably null
R7121:Lmo7 UTSW 14 101887035 missense probably damaging 1.00
R7136:Lmo7 UTSW 14 101920539 missense unknown
R7196:Lmo7 UTSW 14 101896500 missense possibly damaging 0.75
R7228:Lmo7 UTSW 14 101896535 missense probably damaging 0.99
R7337:Lmo7 UTSW 14 101884204 missense probably damaging 0.98
R7341:Lmo7 UTSW 14 101885512 missense probably benign 0.30
R7408:Lmo7 UTSW 14 101880953 missense probably damaging 1.00
R7432:Lmo7 UTSW 14 101902115 missense probably benign 0.42
R7470:Lmo7 UTSW 14 101900604 missense possibly damaging 0.83
R7506:Lmo7 UTSW 14 101919609 missense unknown
R7559:Lmo7 UTSW 14 101887226 nonsense probably null
R7565:Lmo7 UTSW 14 101885301 missense probably damaging 0.98
R7788:Lmo7 UTSW 14 101898576 missense possibly damaging 0.64
X0066:Lmo7 UTSW 14 101887461 missense probably damaging 1.00
X0067:Lmo7 UTSW 14 101886933 splice site probably null
Predicted Primers PCR Primer
(F):5'- CCTCGTGGGTCTTATCACAAC -3'
(R):5'- ACTACCTTGAAAATGTTCCGTCTG -3'

Sequencing Primer
(F):5'- GTGGGTCTTATCACAACTTCTTGAC -3'
(R):5'- CTGTGTAGACCGGGCTTGC -3'
Posted On2019-05-13