Mutagenetix > Incidental Mutations

Incidental Mutation 'R7064:Lmo7'

548472

Institutional Source

Beutler Lab

Gene Symbol

Lmo7

Ensembl Gene

ENSMUSG00000033060

Gene Name

LIM domain only 7

Synonyms

FBXO20, LOC380928

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.230) question?

Stock #

R7064 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

101729957-101934710 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 101884179 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 227 (D227N)

Ref Sequence

ENSEMBL: ENSMUSP00000097910 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100337] [ENSMUST00000159026] [ENSMUST00000159258] [ENSMUST00000159314] [ENSMUST00000159597]

Predicted Effect

probably damaging
Transcript: ENSMUST00000100337
AA Change: D227N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000097910
Gene: ENSMUSG00000033060
AA Change: D227N

Domain	Start	End	E-Value	Type
CH	14	124	2.57e-13	SMART
low complexity region	200	211	N/A	INTRINSIC
Pfam:DUF4757	242	348	2.2e-14	PFAM
low complexity region	448	462	N/A	INTRINSIC
Pfam:DUF4757	568	735	1.8e-46	PFAM
low complexity region	861	879	N/A	INTRINSIC
low complexity region	979	991	N/A	INTRINSIC
low complexity region	1003	1015	N/A	INTRINSIC
PDZ	1047	1119	1.05e-8	SMART
coiled coil region	1222	1275	N/A	INTRINSIC
coiled coil region	1319	1411	N/A	INTRINSIC
low complexity region	1585	1596	N/A	INTRINSIC
low complexity region	1599	1617	N/A	INTRINSIC
LIM	1629	1687	6.54e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000159026

SMART Domains

Protein: ENSMUSP00000124605
Gene: ENSMUSG00000033060

Domain	Start	End	E-Value	Type
low complexity region	215	229	N/A	INTRINSIC
coiled coil region	435	471	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000159258

SMART Domains

Protein: ENSMUSP00000125465
Gene: ENSMUSG00000033060

Domain	Start	End	E-Value	Type
low complexity region	215	229	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000159314

SMART Domains

Protein: ENSMUSP00000124349
Gene: ENSMUSG00000033060

Domain	Start	End	E-Value	Type
low complexity region	215	229	N/A	INTRINSIC
coiled coil region	435	492	N/A	INTRINSIC
low complexity region	628	646	N/A	INTRINSIC
low complexity region	746	758	N/A	INTRINSIC
low complexity region	770	782	N/A	INTRINSIC
PDZ	814	886	1.05e-8	SMART
coiled coil region	989	1042	N/A	INTRINSIC
coiled coil region	1086	1178	N/A	INTRINSIC
low complexity region	1352	1363	N/A	INTRINSIC
low complexity region	1366	1384	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000159597
AA Change: D105N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000123706
Gene: ENSMUSG00000033060
AA Change: D105N

Domain	Start	End	E-Value	Type
low complexity region	78	89	N/A	INTRINSIC
internal_repeat_1	111	141	6.96e-5	PROSPERO
internal_repeat_1	218	248	6.96e-5	PROSPERO
low complexity region	326	340	N/A	INTRINSIC
coiled coil region	546	603	N/A	INTRINSIC
low complexity region	739	757	N/A	INTRINSIC
low complexity region	857	869	N/A	INTRINSIC
low complexity region	881	893	N/A	INTRINSIC
PDZ	925	997	1.05e-8	SMART
coiled coil region	1127	1180	N/A	INTRINSIC
coiled coil region	1224	1316	N/A	INTRINSIC
low complexity region	1490	1501	N/A	INTRINSIC
low complexity region	1504	1522	N/A	INTRINSIC
LIM	1534	1592	6.54e-10	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000124300
Gene: ENSMUSG00000033060
AA Change: D60N

Domain	Start	End	E-Value	Type
low complexity region	34	45	N/A	INTRINSIC
Pfam:DUF4757	76	225	4.5e-53	PFAM
low complexity region	351	369	N/A	INTRINSIC
low complexity region	469	481	N/A	INTRINSIC
low complexity region	493	505	N/A	INTRINSIC
PDZ	537	609	1.05e-8	SMART
internal_repeat_1	620	691	9.31e-5	PROSPERO
coiled coil region	711	764	N/A	INTRINSIC
coiled coil region	808	900	N/A	INTRINSIC
internal_repeat_1	921	976	9.31e-5	PROSPERO
low complexity region	1075	1086	N/A	INTRINSIC
low complexity region	1089	1107	N/A	INTRINSIC
LIM	1119	1177	6.54e-10	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a calponin homology (CH) domain, a PDZ domain, and a LIM domain, and may be involved in protein-protein interactions. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene, however, the full-length nature of some variants is not known. [provided by RefSeq, Jan 2009]
PHENOTYPE: Targeted mutations in this gene result in postnatal lethality, growth defects, skeletal muscle abnormalities and retinal defects reflective of retinal degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadat	T	C	8: 60,531,712	I263T	probably damaging	Het
Adamtsl1	C	T	4: 86,342,041	P830S	possibly damaging	Het
Adrb1	T	C	19: 56,723,024	F218S	probably damaging	Het
Ahnak2	T	C	12: 112,780,742		probably benign	Het
Arsj	T	A	3: 126,438,337	V244E	probably damaging	Het
Atm	T	C	9: 53,507,881	E757G	probably benign	Het
AU040320	A	G	4: 126,792,072	D147G	probably benign	Het
Btnl10	A	T	11: 58,919,308	M92L	possibly damaging	Het
Chd6	T	C	2: 160,950,063	D2458G	probably damaging	Het
Cntn3	T	C	6: 102,273,811	I259V	probably damaging	Het
Ctns	A	G	11: 73,186,392	V250A	probably benign	Het
Cxxc1	T	A	18: 74,220,607		probably null	Het
Cyp2a4	A	T	7: 26,312,307	M318L	probably benign	Het
Dchs1	A	G	7: 105,763,185	L1302P	probably damaging	Het
Decr1	C	A	4: 15,945,392			Het
Dmbx1	T	C	4: 115,918,268	N272D	probably damaging	Het
Dsel	C	A	1: 111,862,847		probably benign	Het
Dspp	A	C	5: 104,176,938	D389A	possibly damaging	Het
Ero1l	T	C	14: 45,306,592	T52A	probably damaging	Het
Fam186a	T	C	15: 99,941,676	E2229G	unknown	Het
Fam208a	C	T	14: 27,472,331	P1163S	probably benign	Het
Gabrd	C	T	4: 155,388,346	V127M	probably damaging	Het
Gpc2	A	T	5: 138,278,910	F85Y	probably damaging	Het
Gucy2g	A	G	19: 55,210,332	L793S	probably benign	Het
Itpr3	G	C	17: 27,089,295	G298R	probably damaging	Het
Kalrn	A	T	16: 34,217,891	C1024S	probably damaging	Het
Krt40	T	C	11: 99,540,128	Y185C	probably benign	Het
Mmrn1	T	A	6: 60,988,540	L1184*	probably null	Het
Mrvi1	C	G	7: 110,895,854	E455Q	probably damaging	Het
Olfr113	T	A	17: 37,574,743	R227W	probably damaging	Het
Olfr1211	T	A	2: 88,929,509	M269L	probably benign	Het
Olfr982	T	A	9: 40,074,813	Y173N	probably damaging	Het
Parp9	T	G	16: 35,953,672	V338G	probably benign	Het
Pcdh15	G	A	10: 74,630,614	E888K	possibly damaging	Het
Pcdh9	C	T	14: 93,886,149	E862K	probably damaging	Het
Prkdc	A	G	16: 15,790,453	T3040A	probably benign	Het
Qser1	T	C	2: 104,787,119	E1026G	probably damaging	Het
Rnf20	C	T	4: 49,644,580	R282*	probably null	Het
Rpgrip1l	T	A	8: 91,263,520	K765*	probably null	Het
Rprd2	G	A	3: 95,765,016	T1025M	probably damaging	Het
Scn4a	A	G	11: 106,322,157	Y1341H	possibly damaging	Het
Scn5a	C	G	9: 119,489,911	D1554H	probably damaging	Het
Sept14	T	C	5: 129,697,806	I102V	probably benign	Het
Sept4	A	G	11: 87,590,367	T378A	probably benign	Het
Siglec1	C	T	2: 131,083,914	G291R	probably benign	Het
Sik2	A	G	9: 50,907,420	V418A	probably damaging	Het
Slc9a5	A	G	8: 105,349,446	T24A	possibly damaging	Het
Spata31d1b	T	C	13: 59,716,141	S368P	probably benign	Het
Stip1	T	C	19: 7,035,557	D53G	probably benign	Het
Stk36	T	C	1: 74,610,820	W245R	probably damaging	Het
Stk39	A	T	2: 68,358,812		probably null	Het
Tacr2	T	C	10: 62,261,497	M252T	probably damaging	Het
Terb1	A	T	8: 104,488,554	N263K	probably benign	Het
Tgm5	T	C	2: 121,053,514	M333V	probably benign	Het
Tmem45a	T	C	16: 56,822,404	M135V	probably benign	Het
Trmt13	T	A	3: 116,582,697	K348N	probably damaging	Het
Trmt2a	A	T	16: 18,253,004	M534L	probably damaging	Het
Ttll13	G	A	7: 80,257,030	R513K	probably null	Het
Vmn1r228	T	A	17: 20,777,023	I78L	probably benign	Het
Washc3	T	C	10: 88,245,773	V173A	possibly damaging	Het
Zc2hc1b	A	T	10: 13,171,305	C21S	probably damaging	Het
Zfp944	T	A	17: 22,339,579	H229L	probably damaging	Het
Zfp985	T	A	4: 147,583,116	I147N	probably benign	Het

Other mutations in Lmo7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00569:Lmo7	APN	14	101887051	missense	probably damaging	0.99
IGL00733:Lmo7	APN	14	101915702	missense	probably damaging	1.00
IGL00778:Lmo7	APN	14	101910885	splice site	probably benign
IGL01014:Lmo7	APN	14	101920557	splice site	probably benign
IGL01401:Lmo7	APN	14	101794277	nonsense	probably null
IGL01550:Lmo7	APN	14	101926140	utr 3 prime	probably benign
IGL01570:Lmo7	APN	14	101902371	critical splice donor site	probably null
IGL01602:Lmo7	APN	14	101910756	splice site	probably benign
IGL01605:Lmo7	APN	14	101910756	splice site	probably benign
IGL02012:Lmo7	APN	14	101888716	intron	probably benign
IGL02145:Lmo7	APN	14	101902223	missense	probably benign	0.00
IGL02236:Lmo7	APN	14	101926088	splice site	probably benign
IGL02318:Lmo7	APN	14	101900066	splice site	probably benign
IGL02345:Lmo7	APN	14	101887473	missense	probably damaging	1.00
IGL02498:Lmo7	APN	14	101807482	missense	probably benign	0.01
IGL02583:Lmo7	APN	14	101933924	utr 3 prime	probably benign
IGL02670:Lmo7	APN	14	101880980	missense	probably damaging	1.00
IGL02694:Lmo7	APN	14	101887170	missense	probably damaging	1.00
IGL03026:Lmo7	APN	14	101929333	utr 3 prime	probably benign
IGL03062:Lmo7	APN	14	101912079	missense	possibly damaging	0.66
IGL03068:Lmo7	APN	14	101875492	unclassified	probably benign
IGL03178:Lmo7	APN	14	101929260	nonsense	probably null
IGL03279:Lmo7	APN	14	101900508	missense	probably benign	0.30
PIT4458001:Lmo7	UTSW	14	101887487	nonsense	probably null
R0029:Lmo7	UTSW	14	101933921	utr 3 prime	probably benign
R0112:Lmo7	UTSW	14	101887193	nonsense	probably null
R0345:Lmo7	UTSW	14	101876877	missense	probably damaging	1.00
R0372:Lmo7	UTSW	14	101918053	splice site	probably benign
R0393:Lmo7	UTSW	14	101900456	missense	probably benign
R0514:Lmo7	UTSW	14	101887173	missense	probably damaging	1.00
R0514:Lmo7	UTSW	14	101896559	missense	probably damaging	1.00
R0526:Lmo7	UTSW	14	101900560	missense	probably damaging	1.00
R0615:Lmo7	UTSW	14	101876859	nonsense	probably null
R0900:Lmo7	UTSW	14	101887188	missense	probably damaging	1.00
R0961:Lmo7	UTSW	14	101794269	missense	probably benign	0.00
R0964:Lmo7	UTSW	14	101920567	splice site	probably benign
R1078:Lmo7	UTSW	14	101920474	splice site	probably benign
R1252:Lmo7	UTSW	14	101900583	missense	probably damaging	1.00
R1527:Lmo7	UTSW	14	101876828	missense	probably damaging	1.00
R1537:Lmo7	UTSW	14	101929264	utr 3 prime	probably benign
R1565:Lmo7	UTSW	14	101887521	missense	probably damaging	0.99
R1637:Lmo7	UTSW	14	101880832	missense	probably damaging	1.00
R1943:Lmo7	UTSW	14	101902302	missense	probably damaging	1.00
R1967:Lmo7	UTSW	14	101900215	missense	probably benign	0.36
R2002:Lmo7	UTSW	14	101887061	missense	probably benign	0.13
R2057:Lmo7	UTSW	14	101887178	missense	probably damaging	1.00
R2131:Lmo7	UTSW	14	101900238	missense	probably damaging	0.99
R2153:Lmo7	UTSW	14	101920515	utr 3 prime	probably benign
R2257:Lmo7	UTSW	14	101900130	missense	probably damaging	1.00
R2355:Lmo7	UTSW	14	101888685	missense	probably damaging	1.00
R2356:Lmo7	UTSW	14	101886945	missense	probably damaging	1.00
R2898:Lmo7	UTSW	14	101876914	missense	possibly damaging	0.93
R3847:Lmo7	UTSW	14	101922095	critical splice acceptor site	probably null
R3848:Lmo7	UTSW	14	101922095	critical splice acceptor site	probably null
R3849:Lmo7	UTSW	14	101922095	critical splice acceptor site	probably null
R3916:Lmo7	UTSW	14	101929342	utr 3 prime	probably benign
R4050:Lmo7	UTSW	14	101902277	nonsense	probably null
R4326:Lmo7	UTSW	14	101900074	missense	possibly damaging	0.93
R4357:Lmo7	UTSW	14	101887655	missense	probably null	1.00
R4571:Lmo7	UTSW	14	101887594	missense	probably damaging	0.96
R4658:Lmo7	UTSW	14	101886957	missense	probably damaging	1.00
R4857:Lmo7	UTSW	14	101887348	splice site	probably null
R5006:Lmo7	UTSW	14	101926237	utr 3 prime	probably benign
R5528:Lmo7	UTSW	14	101902086	missense	probably damaging	1.00
R5588:Lmo7	UTSW	14	101896590	splice site	probably null
R5643:Lmo7	UTSW	14	101929336	utr 3 prime	probably benign
R5644:Lmo7	UTSW	14	101929336	utr 3 prime	probably benign
R5650:Lmo7	UTSW	14	101898674	missense	probably damaging	1.00
R5737:Lmo7	UTSW	14	101887236	missense	probably damaging	1.00
R5832:Lmo7	UTSW	14	101884213	missense	probably damaging	1.00
R5966:Lmo7	UTSW	14	101900502	missense	possibly damaging	0.92
R6026:Lmo7	UTSW	14	101880990	missense	probably benign	0.04
R6072:Lmo7	UTSW	14	101929336	utr 3 prime	probably benign
R6158:Lmo7	UTSW	14	101900137	missense	probably benign	0.03
R6246:Lmo7	UTSW	14	101918700	missense	probably damaging	1.00
R6335:Lmo7	UTSW	14	101900636	missense	probably damaging	1.00
R6620:Lmo7	UTSW	14	101875452	missense	probably benign	0.29
R6658:Lmo7	UTSW	14	101910845	missense	possibly damaging	0.84
R6917:Lmo7	UTSW	14	101918010	missense	probably damaging	1.00
R7072:Lmo7	UTSW	14	101898700	critical splice donor site	probably null
R7121:Lmo7	UTSW	14	101887035	missense	probably damaging	1.00
R7136:Lmo7	UTSW	14	101920539	missense	unknown
R7196:Lmo7	UTSW	14	101896500	missense	possibly damaging	0.75
R7228:Lmo7	UTSW	14	101896535	missense	probably damaging	0.99
R7337:Lmo7	UTSW	14	101884204	missense	probably damaging	0.98
R7341:Lmo7	UTSW	14	101885512	missense	probably benign	0.30
R7408:Lmo7	UTSW	14	101880953	missense	probably damaging	1.00
R7432:Lmo7	UTSW	14	101902115	missense	probably benign	0.42
R7470:Lmo7	UTSW	14	101900604	missense	possibly damaging	0.83
R7506:Lmo7	UTSW	14	101919609	missense	unknown
R7559:Lmo7	UTSW	14	101887226	nonsense	probably null
R7565:Lmo7	UTSW	14	101885301	missense	probably damaging	0.98
R7788:Lmo7	UTSW	14	101898576	missense	possibly damaging	0.64
R8095:Lmo7	UTSW	14	101887419	missense	possibly damaging	0.88
R8100:Lmo7	UTSW	14	101900463	missense	probably benign	0.33
R8121:Lmo7	UTSW	14	101926300	missense	unknown
R8308:Lmo7	UTSW	14	101902371	critical splice donor site	probably null
R8371:Lmo7	UTSW	14	101887008	missense	possibly damaging	0.95
R8403:Lmo7	UTSW	14	101902364	missense	probably benign	0.03
X0066:Lmo7	UTSW	14	101887461	missense	probably damaging	1.00
X0067:Lmo7	UTSW	14	101886933	splice site	probably null
Z1176:Lmo7	UTSW	14	101884306	missense	probably damaging	0.99
Z1176:Lmo7	UTSW	14	101919281	missense	probably benign	0.00
Z1176:Lmo7	UTSW	14	101919443	missense	unknown
Z1176:Lmo7	UTSW	14	101929228	missense	unknown
Z1177:Lmo7	UTSW	14	101896518	missense	possibly damaging	0.96
Z1177:Lmo7	UTSW	14	101898557	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTCGTGGGTCTTATCACAAC -3'
(R):5'- ACTACCTTGAAAATGTTCCGTCTG -3'

Sequencing Primer
(F):5'- GTGGGTCTTATCACAACTTCTTGAC -3'
(R):5'- CTGTGTAGACCGGGCTTGC -3'

Posted On

2019-05-13