Incidental Mutation 'R7065:Cflar'
ID 548487
Institutional Source Beutler Lab
Gene Symbol Cflar
Ensembl Gene ENSMUSG00000026031
Gene Name CASP8 and FADD-like apoptosis regulator
Synonyms Cash, c-Flip, Flip, 2310024N18Rik, Casper, A430105C05Rik
MMRRC Submission 045161-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7065 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 58750667-58798043 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 58770368 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Valine at position 154 (L154V)
Ref Sequence ENSEMBL: ENSMUSP00000109948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069333] [ENSMUST00000097722] [ENSMUST00000114309] [ENSMUST00000114313]
AlphaFold O35732
Predicted Effect
SMART Domains Protein: ENSMUSP00000065107
Gene: ENSMUSG00000026031
AA Change: L154V

DomainStartEndE-ValueType
DED 6 78 8.94e-22 SMART
DED 96 175 4.33e-29 SMART
CASc 245 480 6.05e-92 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000097722
AA Change: L154V

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000095329
Gene: ENSMUSG00000026031
AA Change: L154V

DomainStartEndE-ValueType
DED 6 78 8.94e-22 SMART
DED 96 175 4.33e-29 SMART
CASc 248 483 6.05e-92 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114309
AA Change: L154V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109948
Gene: ENSMUSG00000026031
AA Change: L154V

DomainStartEndE-ValueType
DED 6 78 8.94e-22 SMART
DED 96 175 4.33e-29 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000109952
Gene: ENSMUSG00000026031
AA Change: L154V

DomainStartEndE-ValueType
DED 6 78 8.94e-22 SMART
DED 96 175 4.33e-29 SMART
CASc 245 480 6.05e-92 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a regulator of apoptosis and is structurally similar to caspase-8. However, the encoded protein lacks caspase activity and appears to be itself cleaved into two peptides by caspase-8. Several transcript variants encoding different isoforms have been found for this gene, and partial evidence for several more variants exists. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality by E10.5. Mutant embryos exhibit cardiac developmental abnormalities and pooling of blood in the head and abdominal regions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G T 4: 53,074,233 (GRCm39) S1150Y probably damaging Het
Abca13 T A 11: 9,242,595 (GRCm39) V1486E probably benign Het
Abca17 T A 17: 24,546,725 (GRCm39) Y292F probably damaging Het
Adam3 A G 8: 25,201,691 (GRCm39) probably null Het
Ankmy2 G A 12: 36,237,707 (GRCm39) E269K probably damaging Het
Cdan1 A G 2: 120,549,402 (GRCm39) S1201P probably benign Het
Cep57 T C 9: 13,729,677 (GRCm39) Y122C probably damaging Het
Cfh T A 1: 140,014,140 (GRCm39) Y1210F probably damaging Het
Chmp4b A G 2: 154,533,162 (GRCm39) D134G probably damaging Het
Clec14a A G 12: 58,315,580 (GRCm39) F14S possibly damaging Het
Ctnna1 A T 18: 35,285,669 (GRCm39) H5L probably benign Het
Cyp2e1 T A 7: 140,343,906 (GRCm39) L48Q probably damaging Het
Dnah6 T G 6: 73,064,545 (GRCm39) Q2627P possibly damaging Het
Ehmt1 T C 2: 24,730,709 (GRCm39) D569G probably damaging Het
Frmd4a G A 2: 4,570,923 (GRCm39) Het
Fryl T C 5: 73,248,099 (GRCm39) D1006G probably damaging Het
Gclm A G 3: 122,056,320 (GRCm39) N137D probably benign Het
Gk5 A G 9: 96,061,109 (GRCm39) Y531C probably damaging Het
Gpm6a C A 8: 55,490,493 (GRCm39) N56K probably benign Het
Grik4 A C 9: 42,455,127 (GRCm39) V656G probably damaging Het
Grip2 C A 6: 91,760,550 (GRCm39) probably null Het
Gucy2c T C 6: 136,697,764 (GRCm39) K636E probably damaging Het
Ifi44l A G 3: 151,465,429 (GRCm39) I107T Het
Kif1b T C 4: 149,286,982 (GRCm39) T1237A possibly damaging Het
Klk1b11 A G 7: 43,648,386 (GRCm39) D131G probably benign Het
Lipe A G 7: 25,084,603 (GRCm39) probably null Het
Lrp4 A G 2: 91,341,925 (GRCm39) D1846G probably damaging Het
Madd A T 2: 90,985,402 (GRCm39) M1273K probably benign Het
Matn3 T A 12: 9,002,472 (GRCm39) M228K probably damaging Het
Mterf4 T A 1: 93,232,617 (GRCm39) H78L probably benign Het
Ncoa4 T A 14: 31,894,857 (GRCm39) L128* probably null Het
Nedd4l A G 18: 65,329,040 (GRCm39) N627S probably benign Het
Niban1 A G 1: 151,575,858 (GRCm39) probably null Het
Nphp3 A G 9: 103,919,189 (GRCm39) Y1279C probably damaging Het
Nrp1 C A 8: 129,187,193 (GRCm39) T413N probably benign Het
Opn4 C A 14: 34,317,834 (GRCm39) A267S probably benign Het
Or4c11c A T 2: 88,661,730 (GRCm39) I90F probably damaging Het
Or5ak24 A G 2: 85,260,523 (GRCm39) Y217H probably damaging Het
Or5al6 A C 2: 85,976,345 (GRCm39) H244Q probably damaging Het
Or5p78 G A 7: 108,212,266 (GRCm39) V251I probably damaging Het
Pax3 T C 1: 78,170,648 (GRCm39) probably null Het
Pcdha12 A G 18: 37,154,679 (GRCm39) E466G probably damaging Het
Pdzk1 A G 3: 96,775,748 (GRCm39) E372G probably benign Het
Pigs T A 11: 78,227,565 (GRCm39) V243D possibly damaging Het
Pla2g5 C A 4: 138,527,915 (GRCm39) C117F probably damaging Het
Ppt2 A G 17: 34,841,829 (GRCm39) S236P probably damaging Het
Raver1 T C 9: 21,001,590 (GRCm39) D81G probably benign Het
Rpgrip1 T C 14: 52,378,650 (GRCm39) L525P possibly damaging Het
Ryr1 T C 7: 28,803,068 (GRCm39) E662G probably damaging Het
Scaf8 G A 17: 3,209,486 (GRCm39) V66M probably damaging Het
Scn3a A C 2: 65,295,199 (GRCm39) L1508R probably benign Het
Semp2l2b T C 10: 21,943,197 (GRCm39) D261G probably benign Het
Slfn8 T C 11: 82,907,794 (GRCm39) R250G probably benign Het
Speer4d A C 5: 15,825,421 (GRCm39) T49P probably damaging Het
Spice1 T A 16: 44,175,898 (GRCm39) D32E probably damaging Het
Stt3b A G 9: 115,095,224 (GRCm39) L269P probably damaging Het
Ttn A G 2: 76,628,456 (GRCm39) I14568T possibly damaging Het
U2surp T C 9: 95,367,712 (GRCm39) T413A probably benign Het
Ubr3 A G 2: 69,784,049 (GRCm39) E755G probably damaging Het
Unc5a A T 13: 55,138,896 (GRCm39) S92C probably damaging Het
Zfat T C 15: 68,052,969 (GRCm39) Y275C probably damaging Het
Zfp874a A T 13: 67,590,401 (GRCm39) S428T probably damaging Het
Zfy1 A G Y: 725,428 (GRCm39) V779A probably benign Het
Other mutations in Cflar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Cflar APN 1 58,771,469 (GRCm39) missense probably benign 0.42
IGL00959:Cflar APN 1 58,768,321 (GRCm39) critical splice donor site probably null
IGL02045:Cflar APN 1 58,791,903 (GRCm39) missense probably benign 0.25
IGL02200:Cflar APN 1 58,791,828 (GRCm39) missense probably damaging 1.00
IGL02382:Cflar APN 1 58,791,840 (GRCm39) missense probably benign 0.14
IGL03032:Cflar APN 1 58,780,179 (GRCm39) missense probably damaging 1.00
Channel_islands UTSW 1 58,793,010 (GRCm39) missense probably benign 0.00
IGL02988:Cflar UTSW 1 58,780,190 (GRCm39) missense possibly damaging 0.58
R1936:Cflar UTSW 1 58,791,784 (GRCm39) nonsense probably null
R2259:Cflar UTSW 1 58,768,280 (GRCm39) missense probably benign 0.16
R2269:Cflar UTSW 1 58,780,206 (GRCm39) critical splice donor site probably null
R3816:Cflar UTSW 1 58,791,582 (GRCm39) missense probably benign 0.24
R3824:Cflar UTSW 1 58,774,856 (GRCm39) missense probably benign 0.00
R4232:Cflar UTSW 1 58,780,152 (GRCm39) missense possibly damaging 0.92
R4644:Cflar UTSW 1 58,770,426 (GRCm39) missense probably damaging 1.00
R4749:Cflar UTSW 1 58,779,431 (GRCm39) missense possibly damaging 0.62
R4765:Cflar UTSW 1 58,771,480 (GRCm39) missense probably damaging 0.98
R4785:Cflar UTSW 1 58,791,726 (GRCm39) missense probably benign 0.34
R5315:Cflar UTSW 1 58,792,961 (GRCm39) missense probably benign 0.34
R5418:Cflar UTSW 1 58,791,810 (GRCm39) missense possibly damaging 0.54
R5509:Cflar UTSW 1 58,791,551 (GRCm39) missense probably benign 0.02
R5858:Cflar UTSW 1 58,793,010 (GRCm39) missense probably benign 0.00
R5899:Cflar UTSW 1 58,791,927 (GRCm39) missense probably benign 0.36
R6048:Cflar UTSW 1 58,780,202 (GRCm39) missense probably benign 0.02
R7144:Cflar UTSW 1 58,793,007 (GRCm39) missense
R7206:Cflar UTSW 1 58,780,150 (GRCm39) missense
R7384:Cflar UTSW 1 58,791,735 (GRCm39) missense
R7453:Cflar UTSW 1 58,792,956 (GRCm39) missense
R7467:Cflar UTSW 1 58,765,597 (GRCm39) start codon destroyed probably null
R7694:Cflar UTSW 1 58,791,966 (GRCm39) missense
R7808:Cflar UTSW 1 58,750,740 (GRCm39) start gained probably benign
R7890:Cflar UTSW 1 58,791,915 (GRCm39) missense
R8073:Cflar UTSW 1 58,791,981 (GRCm39) missense
R9506:Cflar UTSW 1 58,791,975 (GRCm39) missense
Z1176:Cflar UTSW 1 58,779,472 (GRCm39) critical splice donor site probably null
Z1176:Cflar UTSW 1 58,770,388 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- TTCAGTCAAAGTCAGAAGGGTTC -3'
(R):5'- TTGTCTCAACCATGCATCCAAC -3'

Sequencing Primer
(F):5'- AGCTGTCTGGATGGAGTCACC -3'
(R):5'- CAAACGAATCTTCACAGGCCATTG -3'
Posted On 2019-05-13