Incidental Mutation 'R0612:Dsc1'
ID54849
Institutional Source Beutler Lab
Gene Symbol Dsc1
Ensembl Gene ENSMUSG00000044322
Gene Namedesmocollin 1
SynonymsDsc1a, Dsc1b
MMRRC Submission 038801-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R0612 (G1)
Quality Score130
Status Validated
Chromosome18
Chromosomal Location20084184-20114871 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 20114516 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 14 (K14T)
Ref Sequence ENSEMBL: ENSMUSP00000153126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038710] [ENSMUST00000224432] [ENSMUST00000226115]
Predicted Effect probably benign
Transcript: ENSMUST00000038710
AA Change: K14T

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000042303
Gene: ENSMUSG00000044322
AA Change: K14T

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
Cadherin_pro 29 111 2.61e-41 SMART
CA 155 240 2.78e-9 SMART
CA 264 352 5.94e-27 SMART
CA 375 470 5.27e-10 SMART
CA 493 575 1.18e-21 SMART
Blast:CA 593 672 5e-46 BLAST
transmembrane domain 692 714 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000224432
AA Change: K14T

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224557
Predicted Effect probably damaging
Transcript: ENSMUST00000226115
AA Change: K14T

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.1092 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 93.5%
Validation Efficiency 98% (92/94)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that mediates adhesion in desmosomes. The encoded preproprotein undergoes proteolytic processing to generate the mature, functional protein. Mice lacking the encoded protein exhibit epidermal fragility together with defects of epidermal barrier and differentiation. The neonatal mice lacking the encoded protein exhibit epidermal lesions and older mice develop chronic dermatitis. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mutants with targeted disruptions of this gene have fragile epidermis, flaky skin, and defects in the epidermal barrier, leading to chronic dermatitis and display abnormal epidermal differentiation as indicated by hyperproliferation and overxpression of keratin 6 and 16. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik A G 11: 58,611,973 probably null Het
Abca15 T C 7: 120,337,255 L181P probably damaging Het
Aldh3a1 A T 11: 61,214,619 I184F probably damaging Het
Arl6ip4 A G 5: 124,116,533 S30G probably benign Het
Atp9b T C 18: 80,753,956 E891G possibly damaging Het
Brsk1 T C 7: 4,707,426 L478P possibly damaging Het
Btaf1 G A 19: 36,969,137 V448I probably damaging Het
C330027C09Rik C T 16: 48,999,039 A112V probably benign Het
Cab39 T C 1: 85,818,515 probably null Het
Cacna2d4 G T 6: 119,281,718 probably benign Het
Capzb C T 4: 139,291,029 S253L probably benign Het
Ccdc174 A G 6: 91,890,892 probably benign Het
Ccdc180 C T 4: 45,927,969 A1168V probably damaging Het
Cdh19 T C 1: 110,893,170 probably benign Het
Cdh8 T C 8: 99,400,914 T22A probably benign Het
Cdk10 T C 8: 123,230,680 V181A probably benign Het
Ceacam15 A C 7: 16,673,520 L24* probably null Het
Cftr A C 6: 18,198,126 T20P probably benign Het
Clstn3 T C 6: 124,449,500 T576A probably damaging Het
Col1a2 G A 6: 4,516,003 V165I unknown Het
Copg2 A T 6: 30,861,469 probably null Het
Cps1 A G 1: 67,139,770 H47R probably benign Het
Cytip T C 2: 58,134,190 D206G possibly damaging Het
Dnmt1 C T 9: 20,918,193 E824K probably damaging Het
Dock7 A C 4: 98,989,233 V442G probably benign Het
Dync1h1 C T 12: 110,616,496 P371L probably damaging Het
Enah A G 1: 181,906,448 probably benign Het
Fam189a1 C T 7: 64,761,801 V395M probably benign Het
Fastkd1 T C 2: 69,712,383 T27A probably benign Het
Fcho1 A G 8: 71,715,524 L248P probably damaging Het
Fezf1 A T 6: 23,247,029 V268D probably damaging Het
Fgd2 T A 17: 29,378,347 V547E probably benign Het
Flnb T A 14: 7,887,682 probably benign Het
Gabrg3 A G 7: 56,729,706 M316T probably damaging Het
Gigyf2 T C 1: 87,449,080 F1265L probably damaging Het
Git2 A G 5: 114,752,281 S271P probably damaging Het
Gm13103 G T 4: 143,852,088 probably benign Het
Gm14085 T C 2: 122,521,698 M339T probably damaging Het
Gorab T C 1: 163,397,169 D21G possibly damaging Het
Gpr179 T A 11: 97,338,438 T964S possibly damaging Het
Hdac5 A G 11: 102,196,252 V1042A possibly damaging Het
Hoxa2 T A 6: 52,163,560 T149S probably damaging Het
Igsf8 G T 1: 172,319,407 *108L probably null Het
Il1rap C T 16: 26,701,105 T307M possibly damaging Het
Itih2 T C 2: 10,117,394 D232G probably benign Het
Jak3 A G 8: 71,683,377 Y607C probably damaging Het
Kcnh1 C T 1: 192,277,053 P305L probably damaging Het
Lrrc7 T A 3: 158,164,353 I644F probably damaging Het
Lrrn2 T C 1: 132,937,728 L177P probably damaging Het
Map4k3 C A 17: 80,602,193 K712N probably damaging Het
Med11 A G 11: 70,452,084 T36A probably benign Het
Mmp14 A G 14: 54,440,434 D504G probably damaging Het
Mob1a A G 6: 83,334,158 T120A probably benign Het
Mr1 T A 1: 155,137,690 D47V probably damaging Het
Nacad G T 11: 6,601,382 A603E possibly damaging Het
Nwd1 T A 8: 72,667,680 W524R probably damaging Het
Olfr1508 T C 14: 52,463,551 T153A probably benign Het
Olfr525 T A 7: 140,323,188 M163K possibly damaging Het
Olfr742 A T 14: 50,515,482 T93S probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pde6c T A 19: 38,133,246 C101S probably benign Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Pdlim4 G A 11: 54,068,887 R16C probably damaging Het
Pet2 G A X: 89,405,366 R386* probably null Het
Pfkp A G 13: 6,605,634 probably null Het
Plcg2 T A 8: 117,573,365 S225T probably benign Het
Pramel1 T C 4: 143,397,531 S259P probably damaging Het
Rc3h2 T C 2: 37,411,215 N92D possibly damaging Het
Ric8b C A 10: 85,001,881 N517K probably damaging Het
Rnf34 G A 5: 122,864,174 R65H probably damaging Het
Rraga C T 4: 86,576,327 R137C probably damaging Het
Scube2 C T 7: 109,804,764 probably benign Het
Spata31d1d T C 13: 59,727,973 I583V probably benign Het
Suox T C 10: 128,670,656 E501G probably benign Het
Susd1 A G 4: 59,390,561 probably benign Het
Tac1 T C 6: 7,555,653 S14P probably damaging Het
Tbc1d8 T C 1: 39,372,515 E1080G possibly damaging Het
Tll1 A C 8: 64,071,310 S447R possibly damaging Het
Tmem132e G A 11: 82,443,372 V662M probably damaging Het
Upf2 G T 2: 6,034,098 probably benign Het
Uspl1 A G 5: 149,214,957 E989G probably damaging Het
Vmn1r58 T C 7: 5,410,619 H204R probably damaging Het
Vmn2r25 A T 6: 123,839,522 C367S probably damaging Het
Vps13b A T 15: 35,623,657 Q1240L probably benign Het
Xrcc1 C T 7: 24,570,319 probably benign Het
Yeats2 T G 16: 20,186,425 V385G probably benign Het
Other mutations in Dsc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Dsc1 APN 18 20101886 missense probably damaging 1.00
IGL00571:Dsc1 APN 18 20110138 missense probably damaging 1.00
IGL00790:Dsc1 APN 18 20094896 missense probably damaging 1.00
IGL00963:Dsc1 APN 18 20111986 missense probably null 0.01
IGL00972:Dsc1 APN 18 20088363 missense probably benign 0.32
IGL01112:Dsc1 APN 18 20094622 missense probably benign 0.02
IGL01458:Dsc1 APN 18 20099138 missense probably damaging 1.00
IGL01607:Dsc1 APN 18 20089663 missense probably damaging 1.00
IGL01794:Dsc1 APN 18 20110183 missense probably damaging 1.00
IGL01959:Dsc1 APN 18 20097225 missense probably damaging 1.00
IGL02066:Dsc1 APN 18 20108803 unclassified probably benign
IGL02365:Dsc1 APN 18 20108816 missense probably damaging 1.00
IGL02714:Dsc1 APN 18 20087485 missense probably damaging 1.00
IGL02959:Dsc1 APN 18 20108885 missense probably damaging 1.00
IGL03019:Dsc1 APN 18 20088364 missense probably benign 0.00
IGL03106:Dsc1 APN 18 20086644 splice site probably null
R0414:Dsc1 UTSW 18 20088354 missense possibly damaging 0.85
R0456:Dsc1 UTSW 18 20099112 missense probably damaging 1.00
R0630:Dsc1 UTSW 18 20085862 missense probably damaging 1.00
R0646:Dsc1 UTSW 18 20096057 missense probably damaging 1.00
R0928:Dsc1 UTSW 18 20110249 splice site probably null
R0976:Dsc1 UTSW 18 20095041 splice site probably null
R1221:Dsc1 UTSW 18 20114542 nonsense probably null
R1398:Dsc1 UTSW 18 20088336 missense probably damaging 1.00
R1902:Dsc1 UTSW 18 20095988 missense probably damaging 1.00
R1903:Dsc1 UTSW 18 20095988 missense probably damaging 1.00
R2070:Dsc1 UTSW 18 20088296 splice site probably null
R2119:Dsc1 UTSW 18 20110152 missense probably benign 0.07
R3935:Dsc1 UTSW 18 20097241 missense probably benign 0.00
R4747:Dsc1 UTSW 18 20094558 missense probably damaging 1.00
R5034:Dsc1 UTSW 18 20095027 missense possibly damaging 0.91
R5243:Dsc1 UTSW 18 20099159 missense probably damaging 1.00
R5289:Dsc1 UTSW 18 20101853 missense possibly damaging 0.72
R5300:Dsc1 UTSW 18 20094860 missense probably damaging 1.00
R5354:Dsc1 UTSW 18 20087575 missense probably damaging 1.00
R5376:Dsc1 UTSW 18 20088446 missense probably benign 0.21
R5808:Dsc1 UTSW 18 20086829 nonsense probably null
R5860:Dsc1 UTSW 18 20095024 missense probably damaging 1.00
R6059:Dsc1 UTSW 18 20110242 missense probably damaging 0.98
R6116:Dsc1 UTSW 18 20097299 missense probably benign 0.10
R6351:Dsc1 UTSW 18 20086769 missense probably damaging 1.00
R6422:Dsc1 UTSW 18 20095033 missense probably damaging 1.00
R6811:Dsc1 UTSW 18 20089654 missense probably benign
R6880:Dsc1 UTSW 18 20088372 missense probably damaging 0.99
R6941:Dsc1 UTSW 18 20097189 missense probably benign 0.00
R6997:Dsc1 UTSW 18 20086644 splice site probably null
R7255:Dsc1 UTSW 18 20097273 missense probably benign 0.12
R7456:Dsc1 UTSW 18 20086822 missense probably benign 0.00
R7492:Dsc1 UTSW 18 20107680 missense possibly damaging 0.46
R7503:Dsc1 UTSW 18 20085865 missense probably damaging 1.00
R8030:Dsc1 UTSW 18 20089571 missense not run
Z1176:Dsc1 UTSW 18 20114538 missense not run
Predicted Primers PCR Primer
(F):5'- TCTTAGAACCTTCTGGGCCAAATGC -3'
(R):5'- TGTAGGAAACCCTCTCTCCATGCAC -3'

Sequencing Primer
(F):5'- CTTGGAGAGTAAGCCTATCCC -3'
(R):5'- TCTCCATGCACAGGTAACTGG -3'
Posted On2013-07-11