Incidental Mutation 'R7065:Abca1'
ID548506
Institutional Source Beutler Lab
Gene Symbol Abca1
Ensembl Gene ENSMUSG00000015243
Gene NameATP-binding cassette, sub-family A (ABC1), member 1
SynonymsABC1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7065 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location53030787-53159895 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 53074233 bp
ZygosityHeterozygous
Amino Acid Change Serine to Tyrosine at position 1150 (S1150Y)
Ref Sequence ENSEMBL: ENSMUSP00000030010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030010]
Predicted Effect probably damaging
Transcript: ENSMUST00000030010
AA Change: S1150Y

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030010
Gene: ENSMUSG00000015243
AA Change: S1150Y

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
Pfam:ABC2_membrane_3 395 841 4.9e-14 PFAM
AAA 925 1122 4.2e-10 SMART
low complexity region 1137 1150 N/A INTRINSIC
Pfam:ABC2_membrane_3 1344 1869 1.7e-53 PFAM
low complexity region 1890 1899 N/A INTRINSIC
AAA 1938 2123 3.04e-7 SMART
low complexity region 2176 2187 N/A INTRINSIC
low complexity region 2222 2237 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. In humans, this protein functions as a cholesterol efflux pump in the cellular lipid removal pathway. Mutations in the human gene have been associated with Tangier's disease and familial high-density lipoprotein deficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Many homozygous null mutants die perinatally with placental defects. Survivors show altered steroidogenesis, defective lipid export in Golgi, low serum cholesterol, lipid accumulation in macrophages and lung, reduced fertility and kidney and heart defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik T C 10: 22,067,298 D261G probably benign Het
Abca13 T A 11: 9,292,595 V1486E probably benign Het
Abca17 T A 17: 24,327,751 Y292F probably damaging Het
Adam3 A G 8: 24,711,675 probably null Het
Ankmy2 G A 12: 36,187,708 E269K probably damaging Het
Cdan1 A G 2: 120,718,921 S1201P probably benign Het
Cep57 T C 9: 13,818,381 Y122C probably damaging Het
Cfh T A 1: 140,086,402 Y1210F probably damaging Het
Cflar T G 1: 58,731,209 L154V probably damaging Het
Chmp4b A G 2: 154,691,242 D134G probably damaging Het
Clec14a A G 12: 58,268,794 F14S possibly damaging Het
Ctnna1 A T 18: 35,152,616 H5L probably benign Het
Cyp2e1 T A 7: 140,763,993 L48Q probably damaging Het
Dnah6 T G 6: 73,087,562 Q2627P possibly damaging Het
Ehmt1 T C 2: 24,840,697 D569G probably damaging Het
Fam129a A G 1: 151,700,107 probably null Het
Frmd4a G A 2: 4,566,112 Het
Fryl T C 5: 73,090,756 D1006G probably damaging Het
Gclm A G 3: 122,262,671 N137D probably benign Het
Gk5 A G 9: 96,179,056 Y531C probably damaging Het
Gpm6a C A 8: 55,037,458 N56K probably benign Het
Grik4 A C 9: 42,543,831 V656G probably damaging Het
Grip2 C A 6: 91,783,569 probably null Het
Gucy2c T C 6: 136,720,766 K636E probably damaging Het
Ifi44l A G 3: 151,759,792 I107T Het
Kif1b T C 4: 149,202,525 T1237A possibly damaging Het
Klk1b11 A G 7: 43,998,962 D131G probably benign Het
Lipe A G 7: 25,385,178 probably null Het
Lrp4 A G 2: 91,511,580 D1846G probably damaging Het
Madd A T 2: 91,155,057 M1273K probably benign Het
Matn3 T A 12: 8,952,472 M228K probably damaging Het
Mterf4 T A 1: 93,304,895 H78L probably benign Het
Ncoa4 T A 14: 32,172,900 L128* probably null Het
Nedd4l A G 18: 65,195,969 N627S probably benign Het
Nphp3 A G 9: 104,041,990 Y1279C probably damaging Het
Nrp1 C A 8: 128,460,712 T413N probably benign Het
Olfr1040 A C 2: 86,146,001 H244Q probably damaging Het
Olfr1205 A T 2: 88,831,386 I90F probably damaging Het
Olfr506 G A 7: 108,613,059 V251I probably damaging Het
Olfr994 A G 2: 85,430,179 Y217H probably damaging Het
Opn4 C A 14: 34,595,877 A267S probably benign Het
Pax3 T C 1: 78,194,011 probably null Het
Pcdha12 A G 18: 37,021,626 E466G probably damaging Het
Pdzk1 A G 3: 96,868,432 E372G probably benign Het
Pigs T A 11: 78,336,739 V243D possibly damaging Het
Pla2g5 C A 4: 138,800,604 C117F probably damaging Het
Ppt2 A G 17: 34,622,855 S236P probably damaging Het
Raver1 T C 9: 21,090,294 D81G probably benign Het
Rpgrip1 T C 14: 52,141,193 L525P possibly damaging Het
Ryr1 T C 7: 29,103,643 E662G probably damaging Het
Scaf8 G A 17: 3,159,211 V66M probably damaging Het
Scn3a A C 2: 65,464,855 L1508R probably benign Het
Slfn8 T C 11: 83,016,968 R250G probably benign Het
Speer4d A C 5: 15,620,423 T49P probably damaging Het
Spice1 T A 16: 44,355,535 D32E probably damaging Het
Stt3b A G 9: 115,266,156 L269P probably damaging Het
Ttn A G 2: 76,798,112 I14568T possibly damaging Het
U2surp T C 9: 95,485,659 T413A probably benign Het
Ubr3 A G 2: 69,953,705 E755G probably damaging Het
Unc5a A T 13: 54,991,083 S92C probably damaging Het
Zfat T C 15: 68,181,120 Y275C probably damaging Het
Zfp874a A T 13: 67,442,282 S428T probably damaging Het
Zfy1 A G Y: 725,428 V779A probably benign Het
Other mutations in Abca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Abca1 APN 4 53059255 critical splice donor site probably null
IGL00778:Abca1 APN 4 53086132 missense probably benign
IGL01013:Abca1 APN 4 53038185 nonsense probably null
IGL01510:Abca1 APN 4 53143979 missense probably damaging 0.97
IGL01608:Abca1 APN 4 53038158 missense probably damaging 1.00
IGL01845:Abca1 APN 4 53090297 missense probably damaging 1.00
IGL02048:Abca1 APN 4 53069831 missense probably damaging 1.00
IGL02249:Abca1 APN 4 53068739 nonsense probably null
IGL02569:Abca1 APN 4 53034061 missense probably damaging 1.00
IGL02622:Abca1 APN 4 53034046 missense probably damaging 0.99
R0042:Abca1 UTSW 4 53059245 splice site probably benign
R0042:Abca1 UTSW 4 53059245 splice site probably benign
R0050:Abca1 UTSW 4 53069910 splice site probably benign
R0107:Abca1 UTSW 4 53080834 missense probably benign 0.00
R0127:Abca1 UTSW 4 53067155 missense probably benign 0.00
R0178:Abca1 UTSW 4 53081953 missense possibly damaging 0.89
R0207:Abca1 UTSW 4 53086039 missense probably damaging 0.97
R0267:Abca1 UTSW 4 53046105 missense probably damaging 1.00
R0269:Abca1 UTSW 4 53044228 missense probably benign
R0586:Abca1 UTSW 4 53092860 missense probably benign 0.00
R0587:Abca1 UTSW 4 53107035 missense probably benign 0.00
R1403:Abca1 UTSW 4 53059253 splice site probably benign
R1404:Abca1 UTSW 4 53059253 splice site probably benign
R1405:Abca1 UTSW 4 53059253 splice site probably benign
R1558:Abca1 UTSW 4 53092887 missense probably null 0.00
R1655:Abca1 UTSW 4 53050964 missense probably benign
R1662:Abca1 UTSW 4 53090251 splice site probably null
R1769:Abca1 UTSW 4 53074325 missense probably damaging 1.00
R1898:Abca1 UTSW 4 53071977 missense probably benign 0.08
R1945:Abca1 UTSW 4 53061509 frame shift probably null
R1966:Abca1 UTSW 4 53050409 missense probably damaging 1.00
R2055:Abca1 UTSW 4 53069881 missense probably benign
R2185:Abca1 UTSW 4 53089830 missense probably benign 0.12
R2202:Abca1 UTSW 4 53090291 missense probably damaging 0.96
R2203:Abca1 UTSW 4 53090291 missense probably damaging 0.96
R2204:Abca1 UTSW 4 53090291 missense probably damaging 0.96
R3056:Abca1 UTSW 4 53127626 missense probably benign
R3849:Abca1 UTSW 4 53061481 splice site probably benign
R3850:Abca1 UTSW 4 53061481 splice site probably benign
R3906:Abca1 UTSW 4 53067151 missense possibly damaging 0.84
R3908:Abca1 UTSW 4 53067151 missense possibly damaging 0.84
R4050:Abca1 UTSW 4 53044144 missense probably damaging 1.00
R4204:Abca1 UTSW 4 53090369 missense probably benign 0.00
R4225:Abca1 UTSW 4 53085106 missense possibly damaging 0.87
R4577:Abca1 UTSW 4 53062568 missense possibly damaging 0.94
R4979:Abca1 UTSW 4 53085092 splice site probably null
R5022:Abca1 UTSW 4 53041570 frame shift probably null
R5168:Abca1 UTSW 4 53086070 missense probably benign
R5363:Abca1 UTSW 4 53132963 missense probably benign 0.00
R5439:Abca1 UTSW 4 53042381 missense possibly damaging 0.55
R5604:Abca1 UTSW 4 53067168 splice site probably null
R5614:Abca1 UTSW 4 53046132 missense probably damaging 1.00
R5810:Abca1 UTSW 4 53079631 missense probably benign
R6001:Abca1 UTSW 4 53075555 missense possibly damaging 0.68
R6151:Abca1 UTSW 4 53085261 missense probably benign
R6185:Abca1 UTSW 4 53078089 missense probably benign 0.31
R6262:Abca1 UTSW 4 53092917 missense probably benign 0.01
R6455:Abca1 UTSW 4 53042376 missense probably damaging 0.98
R6472:Abca1 UTSW 4 53085991 critical splice donor site probably null
R6564:Abca1 UTSW 4 53034031 missense possibly damaging 0.85
R6720:Abca1 UTSW 4 53083733 missense probably damaging 1.00
R6903:Abca1 UTSW 4 53143952 missense probably benign 0.17
R6960:Abca1 UTSW 4 53072924 missense probably benign 0.00
R7142:Abca1 UTSW 4 53082050 missense probably damaging 1.00
R7322:Abca1 UTSW 4 53067151 missense probably damaging 0.97
R7520:Abca1 UTSW 4 53078114 missense probably benign
R7547:Abca1 UTSW 4 53109269 missense probably benign 0.02
X0023:Abca1 UTSW 4 53049038 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GCTGGGCTAGAACTAGTGTG -3'
(R):5'- ACACCACATGGACGAAGCTG -3'

Sequencing Primer
(F):5'- AGAGGTCTCCTGGCCTTC -3'
(R):5'- CATGGACGAAGCTGACATCCTTG -3'
Posted On2019-05-13