Mutagenetix > Incidental Mutation

Incidental Mutation 'R7065:Kif1b'

548508

Institutional Source

Beutler Lab

Gene Symbol

Kif1b

Ensembl Gene

ENSMUSG00000063077

Gene Name

kinesin family member 1B

Synonyms

Kif1b beta, KIF1Bp130, A530096N05Rik, D4Mil1e, Kif1b alpha, N-3 kinesin, KIF1Bp204

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7065 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

149176319-149307693 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 149202525 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1237 (T1237A)

Ref Sequence

ENSEMBL: ENSMUSP00000061472 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055647] [ENSMUST00000060537]

AlphaFold

Q60575

Predicted Effect

possibly damaging
Transcript: ENSMUST00000055647
AA Change: T1237A

PolyPhen 2 Score 0.460 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000061472
Gene: ENSMUSG00000063077
AA Change: T1237A

Domain	Start	End	E-Value	Type
KISc	3	356	5.85e-176	SMART
low complexity region	389	404	N/A	INTRINSIC
FHA	509	566	1.61e-4	SMART
coiled coil region	626	685	N/A	INTRINSIC
Pfam:KIF1B	799	846	9.7e-13	PFAM
internal_repeat_1	901	933	7.01e-7	PROSPERO
low complexity region	1165	1179	N/A	INTRINSIC
Pfam:DUF3694	1220	1368	1.1e-46	PFAM
low complexity region	1444	1461	N/A	INTRINSIC
low complexity region	1479	1507	N/A	INTRINSIC
low complexity region	1573	1591	N/A	INTRINSIC
PH	1656	1755	1.02e-14	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000060537
AA Change: T1283A

PolyPhen 2 Score 0.400 (Sensitivity: 0.89; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000056754
Gene: ENSMUSG00000063077
AA Change: T1283A

Domain	Start	End	E-Value	Type
KISc	3	362	7.61e-175	SMART
low complexity region	390	400	N/A	INTRINSIC
low complexity region	432	450	N/A	INTRINSIC
FHA	555	612	1.61e-4	SMART
coiled coil region	672	731	N/A	INTRINSIC
Pfam:KIF1B	845	892	7.1e-15	PFAM
internal_repeat_1	947	979	4.76e-7	PROSPERO
low complexity region	1211	1225	N/A	INTRINSIC
Pfam:DUF3694	1266	1413	1.1e-40	PFAM
low complexity region	1490	1507	N/A	INTRINSIC
low complexity region	1525	1553	N/A	INTRINSIC
low complexity region	1619	1637	N/A	INTRINSIC
PH	1702	1801	1.02e-14	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000139123

SMART Domains

Protein: ENSMUSP00000120076
Gene: ENSMUSG00000063077

Domain	Start	End	E-Value	Type
Pfam:DUF3694	1	92	4.4e-23	PFAM
low complexity region	169	186	N/A	INTRINSIC
low complexity region	204	232	N/A	INTRINSIC
low complexity region	298	316	N/A	INTRINSIC
PH	381	480	1.02e-14	SMART

Meta Mutation Damage Score

0.0768

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a motor protein that transports mitochondria and synaptic vesicle precursors. Mutations in this gene cause Charcot-Marie-Tooth disease, type 2A1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced brain size, elevated pain threshold, and neonatal death from apnea. Heterozygotes exhibit impaired synaptic vesicle precursor transport and progressive muscle weakness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930444G20Rik	T	C	10: 22,067,298	D261G	probably benign	Het
Abca1	G	T	4: 53,074,233	S1150Y	probably damaging	Het
Abca13	T	A	11: 9,292,595	V1486E	probably benign	Het
Abca17	T	A	17: 24,327,751	Y292F	probably damaging	Het
Adam3	A	G	8: 24,711,675		probably null	Het
Ankmy2	G	A	12: 36,187,708	E269K	probably damaging	Het
Cdan1	A	G	2: 120,718,921	S1201P	probably benign	Het
Cep57	T	C	9: 13,818,381	Y122C	probably damaging	Het
Cfh	T	A	1: 140,086,402	Y1210F	probably damaging	Het
Cflar	T	G	1: 58,731,209	L154V	probably damaging	Het
Chmp4b	A	G	2: 154,691,242	D134G	probably damaging	Het
Clec14a	A	G	12: 58,268,794	F14S	possibly damaging	Het
Ctnna1	A	T	18: 35,152,616	H5L	probably benign	Het
Cyp2e1	T	A	7: 140,763,993	L48Q	probably damaging	Het
Dnah6	T	G	6: 73,087,562	Q2627P	possibly damaging	Het
Ehmt1	T	C	2: 24,840,697	D569G	probably damaging	Het
Fam129a	A	G	1: 151,700,107		probably null	Het
Frmd4a	G	A	2: 4,566,112			Het
Fryl	T	C	5: 73,090,756	D1006G	probably damaging	Het
Gclm	A	G	3: 122,262,671	N137D	probably benign	Het
Gk5	A	G	9: 96,179,056	Y531C	probably damaging	Het
Gpm6a	C	A	8: 55,037,458	N56K	probably benign	Het
Grik4	A	C	9: 42,543,831	V656G	probably damaging	Het
Grip2	C	A	6: 91,783,569		probably null	Het
Gucy2c	T	C	6: 136,720,766	K636E	probably damaging	Het
Ifi44l	A	G	3: 151,759,792	I107T		Het
Klk1b11	A	G	7: 43,998,962	D131G	probably benign	Het
Lipe	A	G	7: 25,385,178		probably null	Het
Lrp4	A	G	2: 91,511,580	D1846G	probably damaging	Het
Madd	A	T	2: 91,155,057	M1273K	probably benign	Het
Matn3	T	A	12: 8,952,472	M228K	probably damaging	Het
Mterf4	T	A	1: 93,304,895	H78L	probably benign	Het
Ncoa4	T	A	14: 32,172,900	L128*	probably null	Het
Nedd4l	A	G	18: 65,195,969	N627S	probably benign	Het
Nphp3	A	G	9: 104,041,990	Y1279C	probably damaging	Het
Nrp1	C	A	8: 128,460,712	T413N	probably benign	Het
Olfr1040	A	C	2: 86,146,001	H244Q	probably damaging	Het
Olfr1205	A	T	2: 88,831,386	I90F	probably damaging	Het
Olfr506	G	A	7: 108,613,059	V251I	probably damaging	Het
Olfr994	A	G	2: 85,430,179	Y217H	probably damaging	Het
Opn4	C	A	14: 34,595,877	A267S	probably benign	Het
Pax3	T	C	1: 78,194,011		probably null	Het
Pcdha12	A	G	18: 37,021,626	E466G	probably damaging	Het
Pdzk1	A	G	3: 96,868,432	E372G	probably benign	Het
Pigs	T	A	11: 78,336,739	V243D	possibly damaging	Het
Pla2g5	C	A	4: 138,800,604	C117F	probably damaging	Het
Ppt2	A	G	17: 34,622,855	S236P	probably damaging	Het
Raver1	T	C	9: 21,090,294	D81G	probably benign	Het
Rpgrip1	T	C	14: 52,141,193	L525P	possibly damaging	Het
Ryr1	T	C	7: 29,103,643	E662G	probably damaging	Het
Scaf8	G	A	17: 3,159,211	V66M	probably damaging	Het
Scn3a	A	C	2: 65,464,855	L1508R	probably benign	Het
Slfn8	T	C	11: 83,016,968	R250G	probably benign	Het
Speer4d	A	C	5: 15,620,423	T49P	probably damaging	Het
Spice1	T	A	16: 44,355,535	D32E	probably damaging	Het
Stt3b	A	G	9: 115,266,156	L269P	probably damaging	Het
Ttn	A	G	2: 76,798,112	I14568T	possibly damaging	Het
U2surp	T	C	9: 95,485,659	T413A	probably benign	Het
Ubr3	A	G	2: 69,953,705	E755G	probably damaging	Het
Unc5a	A	T	13: 54,991,083	S92C	probably damaging	Het
Zfat	T	C	15: 68,181,120	Y275C	probably damaging	Het
Zfp874a	A	T	13: 67,442,282	S428T	probably damaging	Het
Zfy1	A	G	Y: 725,428	V779A	probably benign	Het

Other mutations in Kif1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01311:Kif1b	APN	4	149220602	missense	probably damaging	1.00
IGL01943:Kif1b	APN	4	149214905	critical splice donor site	probably null
IGL02240:Kif1b	APN	4	149246414	missense	probably damaging	1.00
IGL02414:Kif1b	APN	4	149199314	missense	probably damaging	0.96
IGL02490:Kif1b	APN	4	149204208	missense	probably benign
IGL02501:Kif1b	APN	4	149214976	missense	probably damaging	1.00
IGL02833:Kif1b	APN	4	149246364	missense	probably damaging	1.00
IGL02852:Kif1b	APN	4	149291328	missense	probably damaging	1.00
IGL02900:Kif1b	APN	4	149180809	missense	possibly damaging	0.81
IGL03287:Kif1b	APN	4	149214981	missense	possibly damaging	0.67
IGL03412:Kif1b	APN	4	149274939	missense	probably benign	0.00
PIT4305001:Kif1b	UTSW	4	149220792	critical splice acceptor site	probably null
R0005:Kif1b	UTSW	4	149181927	missense	probably damaging	1.00
R0044:Kif1b	UTSW	4	149263601	splice site	probably benign
R0044:Kif1b	UTSW	4	149263601	splice site	probably benign
R0129:Kif1b	UTSW	4	149261201	missense	probably benign
R0180:Kif1b	UTSW	4	149213659	missense	probably damaging	1.00
R0288:Kif1b	UTSW	4	149199338	missense	probably damaging	1.00
R0360:Kif1b	UTSW	4	149262729	missense	probably damaging	1.00
R0383:Kif1b	UTSW	4	149202512	missense	probably damaging	1.00
R0398:Kif1b	UTSW	4	149204231	missense	possibly damaging	0.89
R0403:Kif1b	UTSW	4	149181967	nonsense	probably null
R0445:Kif1b	UTSW	4	149188009	missense	probably benign	0.01
R1466:Kif1b	UTSW	4	149223252	missense	probably damaging	0.99
R1466:Kif1b	UTSW	4	149223252	missense	probably damaging	0.99
R1681:Kif1b	UTSW	4	149195501	critical splice acceptor site	probably null
R1728:Kif1b	UTSW	4	149187722	missense	probably damaging	0.99
R1840:Kif1b	UTSW	4	149188132	missense	probably damaging	1.00
R1874:Kif1b	UTSW	4	149187632	missense	probably benign
R1915:Kif1b	UTSW	4	149267216	missense	probably damaging	1.00
R2106:Kif1b	UTSW	4	149187640	missense	possibly damaging	0.92
R2124:Kif1b	UTSW	4	149222296	missense	probably benign	0.08
R2126:Kif1b	UTSW	4	149187640	missense	possibly damaging	0.92
R2127:Kif1b	UTSW	4	149187640	missense	possibly damaging	0.92
R2128:Kif1b	UTSW	4	149187640	missense	possibly damaging	0.92
R2129:Kif1b	UTSW	4	149187640	missense	possibly damaging	0.92
R2146:Kif1b	UTSW	4	149184309	missense	probably damaging	0.99
R2255:Kif1b	UTSW	4	149274997	missense	probably damaging	1.00
R2392:Kif1b	UTSW	4	149220620	missense	possibly damaging	0.93
R2883:Kif1b	UTSW	4	149237648	missense	possibly damaging	0.78
R2981:Kif1b	UTSW	4	149220541	critical splice donor site	probably null
R3038:Kif1b	UTSW	4	149213333	missense	probably benign	0.02
R3616:Kif1b	UTSW	4	149262283	splice site	probably benign
R3935:Kif1b	UTSW	4	149237160	missense	probably benign	0.00
R4347:Kif1b	UTSW	4	149247234	missense	probably damaging	1.00
R4423:Kif1b	UTSW	4	149214105	missense	probably damaging	0.99
R4637:Kif1b	UTSW	4	149199311	missense	probably damaging	0.97
R4745:Kif1b	UTSW	4	149237882	nonsense	probably null
R4807:Kif1b	UTSW	4	149247921	intron	probably benign
R5618:Kif1b	UTSW	4	149269889	missense	possibly damaging	0.94
R5644:Kif1b	UTSW	4	149238482	missense	probably damaging	0.96
R5683:Kif1b	UTSW	4	149222261	missense	probably damaging	1.00
R5696:Kif1b	UTSW	4	149273849	splice site	probably null
R6022:Kif1b	UTSW	4	149198532	missense	probably benign	0.01
R6048:Kif1b	UTSW	4	149263629	missense	probably damaging	1.00
R6137:Kif1b	UTSW	4	149238426	missense	possibly damaging	0.47
R6139:Kif1b	UTSW	4	149237532	missense	possibly damaging	0.88
R6171:Kif1b	UTSW	4	149258048	missense	probably damaging	1.00
R6250:Kif1b	UTSW	4	149213643	missense	probably benign	0.00
R6423:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6424:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6425:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6443:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6460:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6462:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6463:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6469:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6470:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6471:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6472:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6504:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6536:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6537:Kif1b	UTSW	4	149192596	missense	probably benign	0.16
R6668:Kif1b	UTSW	4	149213407	missense	probably benign	0.09
R6698:Kif1b	UTSW	4	149274956	missense	probably damaging	0.99
R7222:Kif1b	UTSW	4	149225157	missense	probably damaging	1.00
R7342:Kif1b	UTSW	4	149214090	missense	possibly damaging	0.94
R7720:Kif1b	UTSW	4	149182355	missense	probably benign	0.01
R7744:Kif1b	UTSW	4	149237075	missense	possibly damaging	0.83
R7797:Kif1b	UTSW	4	149237387	missense	probably benign
R7829:Kif1b	UTSW	4	149220990	splice site	probably null
R7869:Kif1b	UTSW	4	149184376	missense	probably benign	0.01
R7878:Kif1b	UTSW	4	149214997	missense	probably damaging	0.98
R7980:Kif1b	UTSW	4	149269921	missense	probably damaging	1.00
R8047:Kif1b	UTSW	4	149214922	missense	probably damaging	1.00
R8237:Kif1b	UTSW	4	149191185	missense	probably benign	0.10
R8243:Kif1b	UTSW	4	149204267	missense	probably benign
R8252:Kif1b	UTSW	4	149273805	missense	probably damaging	1.00
R8342:Kif1b	UTSW	4	149222348	missense	probably damaging	0.96
R8460:Kif1b	UTSW	4	149187620	missense	possibly damaging	0.93
R8462:Kif1b	UTSW	4	149182340	missense	probably benign	0.05
R8496:Kif1b	UTSW	4	149192611	nonsense	probably null
R8687:Kif1b	UTSW	4	149261163	nonsense	probably null
R8694:Kif1b	UTSW	4	149220567	missense	probably damaging	0.98
R8842:Kif1b	UTSW	4	149253739	missense	probably damaging	0.98
R8883:Kif1b	UTSW	4	149276885	missense	probably benign
R8971:Kif1b	UTSW	4	149247816	missense	probably damaging	1.00
R8994:Kif1b	UTSW	4	149195482	missense
R9002:Kif1b	UTSW	4	149191255	missense	probably damaging	0.96
R9227:Kif1b	UTSW	4	149237900	missense	probably damaging	1.00
R9231:Kif1b	UTSW	4	149191195	missense	possibly damaging	0.94
R9450:Kif1b	UTSW	4	149238010	missense	probably benign	0.01
R9478:Kif1b	UTSW	4	149261159	critical splice donor site	probably null
R9571:Kif1b	UTSW	4	149220641	missense	probably damaging	1.00
R9644:Kif1b	UTSW	4	149291379	missense	probably damaging	1.00
RF008:Kif1b	UTSW	4	149251738	splice site	probably null
X0009:Kif1b	UTSW	4	149247264	missense	probably damaging	1.00
X0062:Kif1b	UTSW	4	149275005	missense	probably damaging	1.00
Z1176:Kif1b	UTSW	4	149266298	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- GCACAGAGAAACCCTGTCTTG -3'
(R):5'- TGACTCTGTGGTGACATGCC -3'

Sequencing Primer
(F):5'- GTTCTATTACTCGACAAAACTCTGAC -3'
(R):5'- TCTGTGGTGACATGCCTCACG -3'

Posted On

2019-05-13