Incidental Mutation 'R7065:Olfr506'
ID548517
Institutional Source Beutler Lab
Gene Symbol Olfr506
Ensembl Gene ENSMUSG00000058244
Gene Nameolfactory receptor 506
SynonymsGA_x6K02T2PBJ9-10942040-10942984, MOR204-23
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R7065 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location108610787-108615340 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 108613059 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 251 (V251I)
Ref Sequence ENSEMBL: ENSMUSP00000147623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077343] [ENSMUST00000209296]
Predicted Effect probably damaging
Transcript: ENSMUST00000077343
AA Change: V251I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000076566
Gene: ENSMUSG00000058244
AA Change: V251I

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 1e-53 PFAM
Pfam:7tm_1 44 293 4e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209296
AA Change: V251I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik T C 10: 22,067,298 D261G probably benign Het
Abca1 G T 4: 53,074,233 S1150Y probably damaging Het
Abca13 T A 11: 9,292,595 V1486E probably benign Het
Abca17 T A 17: 24,327,751 Y292F probably damaging Het
Adam3 A G 8: 24,711,675 probably null Het
Ankmy2 G A 12: 36,187,708 E269K probably damaging Het
Cdan1 A G 2: 120,718,921 S1201P probably benign Het
Cep57 T C 9: 13,818,381 Y122C probably damaging Het
Cfh T A 1: 140,086,402 Y1210F probably damaging Het
Cflar T G 1: 58,731,209 L154V probably damaging Het
Chmp4b A G 2: 154,691,242 D134G probably damaging Het
Clec14a A G 12: 58,268,794 F14S possibly damaging Het
Ctnna1 A T 18: 35,152,616 H5L probably benign Het
Cyp2e1 T A 7: 140,763,993 L48Q probably damaging Het
Dnah6 T G 6: 73,087,562 Q2627P possibly damaging Het
Ehmt1 T C 2: 24,840,697 D569G probably damaging Het
Fam129a A G 1: 151,700,107 probably null Het
Frmd4a G A 2: 4,566,112 Het
Fryl T C 5: 73,090,756 D1006G probably damaging Het
Gclm A G 3: 122,262,671 N137D probably benign Het
Gk5 A G 9: 96,179,056 Y531C probably damaging Het
Gpm6a C A 8: 55,037,458 N56K probably benign Het
Grik4 A C 9: 42,543,831 V656G probably damaging Het
Grip2 C A 6: 91,783,569 probably null Het
Gucy2c T C 6: 136,720,766 K636E probably damaging Het
Ifi44l A G 3: 151,759,792 I107T Het
Kif1b T C 4: 149,202,525 T1237A possibly damaging Het
Klk1b11 A G 7: 43,998,962 D131G probably benign Het
Lipe A G 7: 25,385,178 probably null Het
Lrp4 A G 2: 91,511,580 D1846G probably damaging Het
Madd A T 2: 91,155,057 M1273K probably benign Het
Matn3 T A 12: 8,952,472 M228K probably damaging Het
Mterf4 T A 1: 93,304,895 H78L probably benign Het
Ncoa4 T A 14: 32,172,900 L128* probably null Het
Nedd4l A G 18: 65,195,969 N627S probably benign Het
Nphp3 A G 9: 104,041,990 Y1279C probably damaging Het
Nrp1 C A 8: 128,460,712 T413N probably benign Het
Olfr1040 A C 2: 86,146,001 H244Q probably damaging Het
Olfr1205 A T 2: 88,831,386 I90F probably damaging Het
Olfr994 A G 2: 85,430,179 Y217H probably damaging Het
Opn4 C A 14: 34,595,877 A267S probably benign Het
Pax3 T C 1: 78,194,011 probably null Het
Pcdha12 A G 18: 37,021,626 E466G probably damaging Het
Pdzk1 A G 3: 96,868,432 E372G probably benign Het
Pigs T A 11: 78,336,739 V243D possibly damaging Het
Pla2g5 C A 4: 138,800,604 C117F probably damaging Het
Ppt2 A G 17: 34,622,855 S236P probably damaging Het
Raver1 T C 9: 21,090,294 D81G probably benign Het
Rpgrip1 T C 14: 52,141,193 L525P possibly damaging Het
Ryr1 T C 7: 29,103,643 E662G probably damaging Het
Scaf8 G A 17: 3,159,211 V66M probably damaging Het
Scn3a A C 2: 65,464,855 L1508R probably benign Het
Slfn8 T C 11: 83,016,968 R250G probably benign Het
Speer4d A C 5: 15,620,423 T49P probably damaging Het
Spice1 T A 16: 44,355,535 D32E probably damaging Het
Stt3b A G 9: 115,266,156 L269P probably damaging Het
Ttn A G 2: 76,798,112 I14568T possibly damaging Het
U2surp T C 9: 95,485,659 T413A probably benign Het
Ubr3 A G 2: 69,953,705 E755G probably damaging Het
Unc5a A T 13: 54,991,083 S92C probably damaging Het
Zfat T C 15: 68,181,120 Y275C probably damaging Het
Zfp874a A T 13: 67,442,282 S428T probably damaging Het
Zfy1 A G Y: 725,428 V779A probably benign Het
Other mutations in Olfr506
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01825:Olfr506 APN 7 108613054 missense probably damaging 0.97
IGL02480:Olfr506 APN 7 108612811 missense probably benign
IGL02802:Olfr506 UTSW 7 108612462 missense probably damaging 0.99
R0294:Olfr506 UTSW 7 108613150 missense probably damaging 1.00
R0398:Olfr506 UTSW 7 108612955 missense probably benign 0.30
R0452:Olfr506 UTSW 7 108612370 missense possibly damaging 0.62
R3788:Olfr506 UTSW 7 108613073 nonsense probably null
R7345:Olfr506 UTSW 7 108613063 missense probably benign 0.11
R7671:Olfr506 UTSW 7 108612991 missense probably damaging 1.00
R8270:Olfr506 UTSW 7 108612943 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- AAGTGGTTTTCTTAATGCATCCTCC -3'
(R):5'- AGTTGTCTCTTCAGAGCACC -3'

Sequencing Primer
(F):5'- TGAACTCTCTTGTTCTGATGACAG -3'
(R):5'- AGAGCACCCTTAATCTCATTATTCC -3'
Posted On2019-05-13