Incidental Mutation 'R7065:Gpm6a'
ID548520
Institutional Source Beutler Lab
Gene Symbol Gpm6a
Ensembl Gene ENSMUSG00000031517
Gene Nameglycoprotein m6a
SynonymsM6A, Gpm6
MMRRC Submission
Accession Numbers

Genbank: NM_153581; MGI: 107671

Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R7065 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location54954843-55060871 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 55037458 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 56 (N56K)
Ref Sequence ENSEMBL: ENSMUSP00000033915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033915]
Predicted Effect probably benign
Transcript: ENSMUST00000033915
AA Change: N56K

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000033915
Gene: ENSMUSG00000031517
AA Change: N56K

DomainStartEndE-ValueType
PLP 157 212 1.28e-31 SMART
low complexity region 213 227 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (62/62)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in increased percentage of total body fat and total body fat mass. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik T C 10: 22,067,298 D261G probably benign Het
Abca1 G T 4: 53,074,233 S1150Y probably damaging Het
Abca13 T A 11: 9,292,595 V1486E probably benign Het
Abca17 T A 17: 24,327,751 Y292F probably damaging Het
Adam3 A G 8: 24,711,675 probably null Het
Ankmy2 G A 12: 36,187,708 E269K probably damaging Het
Cdan1 A G 2: 120,718,921 S1201P probably benign Het
Cep57 T C 9: 13,818,381 Y122C probably damaging Het
Cfh T A 1: 140,086,402 Y1210F probably damaging Het
Cflar T G 1: 58,731,209 L154V probably damaging Het
Chmp4b A G 2: 154,691,242 D134G probably damaging Het
Clec14a A G 12: 58,268,794 F14S possibly damaging Het
Ctnna1 A T 18: 35,152,616 H5L probably benign Het
Cyp2e1 T A 7: 140,763,993 L48Q probably damaging Het
Dnah6 T G 6: 73,087,562 Q2627P possibly damaging Het
Ehmt1 T C 2: 24,840,697 D569G probably damaging Het
Fam129a A G 1: 151,700,107 probably null Het
Frmd4a G A 2: 4,566,112 Het
Fryl T C 5: 73,090,756 D1006G probably damaging Het
Gclm A G 3: 122,262,671 N137D probably benign Het
Gk5 A G 9: 96,179,056 Y531C probably damaging Het
Grik4 A C 9: 42,543,831 V656G probably damaging Het
Grip2 C A 6: 91,783,569 probably null Het
Gucy2c T C 6: 136,720,766 K636E probably damaging Het
Ifi44l A G 3: 151,759,792 I107T Het
Kif1b T C 4: 149,202,525 T1237A possibly damaging Het
Klk1b11 A G 7: 43,998,962 D131G probably benign Het
Lipe A G 7: 25,385,178 probably null Het
Lrp4 A G 2: 91,511,580 D1846G probably damaging Het
Madd A T 2: 91,155,057 M1273K probably benign Het
Matn3 T A 12: 8,952,472 M228K probably damaging Het
Mterf4 T A 1: 93,304,895 H78L probably benign Het
Ncoa4 T A 14: 32,172,900 L128* probably null Het
Nedd4l A G 18: 65,195,969 N627S probably benign Het
Nphp3 A G 9: 104,041,990 Y1279C probably damaging Het
Nrp1 C A 8: 128,460,712 T413N probably benign Het
Olfr1040 A C 2: 86,146,001 H244Q probably damaging Het
Olfr1205 A T 2: 88,831,386 I90F probably damaging Het
Olfr506 G A 7: 108,613,059 V251I probably damaging Het
Olfr994 A G 2: 85,430,179 Y217H probably damaging Het
Opn4 C A 14: 34,595,877 A267S probably benign Het
Pax3 T C 1: 78,194,011 probably null Het
Pcdha12 A G 18: 37,021,626 E466G probably damaging Het
Pdzk1 A G 3: 96,868,432 E372G probably benign Het
Pigs T A 11: 78,336,739 V243D possibly damaging Het
Pla2g5 C A 4: 138,800,604 C117F probably damaging Het
Ppt2 A G 17: 34,622,855 S236P probably damaging Het
Raver1 T C 9: 21,090,294 D81G probably benign Het
Rpgrip1 T C 14: 52,141,193 L525P possibly damaging Het
Ryr1 T C 7: 29,103,643 E662G probably damaging Het
Scaf8 G A 17: 3,159,211 V66M probably damaging Het
Scn3a A C 2: 65,464,855 L1508R probably benign Het
Slfn8 T C 11: 83,016,968 R250G probably benign Het
Speer4d A C 5: 15,620,423 T49P probably damaging Het
Spice1 T A 16: 44,355,535 D32E probably damaging Het
Stt3b A G 9: 115,266,156 L269P probably damaging Het
Ttn A G 2: 76,798,112 I14568T possibly damaging Het
U2surp T C 9: 95,485,659 T413A probably benign Het
Ubr3 A G 2: 69,953,705 E755G probably damaging Het
Unc5a A T 13: 54,991,083 S92C probably damaging Het
Zfat T C 15: 68,181,120 Y275C probably damaging Het
Zfp874a A T 13: 67,442,282 S428T probably damaging Het
Zfy1 A G Y: 725,428 V779A probably benign Het
Other mutations in Gpm6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01957:Gpm6a APN 8 55050177 missense probably benign
IGL02591:Gpm6a APN 8 55058919 missense probably damaging 1.00
IGL03257:Gpm6a APN 8 55037472 missense probably damaging 1.00
F2404:Gpm6a UTSW 8 55058882 missense probably damaging 1.00
R0533:Gpm6a UTSW 8 55055374 critical splice acceptor site probably null
R0827:Gpm6a UTSW 8 55058883 missense probably damaging 1.00
R1193:Gpm6a UTSW 8 55047233 critical splice acceptor site probably null
R1468:Gpm6a UTSW 8 55037350 missense probably damaging 0.98
R1468:Gpm6a UTSW 8 55037350 missense probably damaging 0.98
R1793:Gpm6a UTSW 8 55054832 missense probably benign 0.13
R1879:Gpm6a UTSW 8 55037330 missense probably damaging 1.00
R2157:Gpm6a UTSW 8 55058798 missense probably damaging 0.99
R4306:Gpm6a UTSW 8 55047393 critical splice donor site probably null
R4307:Gpm6a UTSW 8 55047393 critical splice donor site probably null
R4417:Gpm6a UTSW 8 55050188 missense probably damaging 1.00
R6058:Gpm6a UTSW 8 55058798 missense probably damaging 0.99
R6112:Gpm6a UTSW 8 55054810 missense probably benign
R6254:Gpm6a UTSW 8 55047396 splice site probably null
R7076:Gpm6a UTSW 8 55037451 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTTGAGGTCATAGAAACATTTTACC -3'
(R):5'- TCTGAATCATGTTTGCCTCATG -3'

Sequencing Primer
(F):5'- CTCCTTCTCCTTCTCCTTCTCC -3'
(R):5'- ATTTTATTTTTGTTTGTTTGCTGTCG -3'
Posted On2019-05-13