Incidental Mutation 'R7065:Rpgrip1'
ID548539
Institutional Source Beutler Lab
Gene Symbol Rpgrip1
Ensembl Gene ENSMUSG00000057132
Gene Nameretinitis pigmentosa GTPase regulator interacting protein 1
SynonymsA930002K18Rik, 4930505G06Rik, 4930401L23Rik, nmf247
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.318) question?
Stock #R7065 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location52110704-52163546 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52141193 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 525 (L525P)
Ref Sequence ENSEMBL: ENSMUSP00000138027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111600] [ENSMUST00000111603] [ENSMUST00000180646] [ENSMUST00000181401]
Predicted Effect possibly damaging
Transcript: ENSMUST00000111600
AA Change: L525P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107227
Gene: ENSMUSG00000057132
AA Change: L525P

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
coiled coil region 248 348 N/A INTRINSIC
coiled coil region 499 542 N/A INTRINSIC
C2 602 707 1.08e-2 SMART
coiled coil region 746 795 N/A INTRINSIC
Blast:C2 958 1086 1e-37 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000111603
AA Change: L525P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107230
Gene: ENSMUSG00000057132
AA Change: L525P

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
coiled coil region 248 348 N/A INTRINSIC
coiled coil region 499 543 N/A INTRINSIC
Pfam:C2-C2_1 582 721 1.9e-49 PFAM
C2 764 869 7.3e-5 SMART
coiled coil region 910 999 N/A INTRINSIC
Blast:C2 1162 1290 2e-37 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000180513
Predicted Effect probably benign
Transcript: ENSMUST00000180646
SMART Domains Protein: ENSMUSP00000137751
Gene: ENSMUSG00000057132

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
coiled coil region 248 276 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000181401
AA Change: L525P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000138027
Gene: ENSMUSG00000057132
AA Change: L525P

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
coiled coil region 248 348 N/A INTRINSIC
coiled coil region 499 547 N/A INTRINSIC
Pfam:DUF3250 605 710 2.8e-46 PFAM
C2 753 858 1.08e-2 SMART
coiled coil region 899 988 N/A INTRINSIC
Blast:C2 1151 1279 1e-37 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000181627
Predicted Effect probably benign
Transcript: ENSMUST00000181709
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a photoreceptor protein that interacts with retinitis pigmentosa GTPase regulator protein and is a key component of cone and rod photoreceptor cells. Mutations in this gene lead to autosomal recessive congenital blindness. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutation of this gene results in photoreceptor cell dysmorphology. By 3 months of age mutant animals show near complete loss of photoreceptor cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik T C 10: 22,067,298 D261G probably benign Het
Abca1 G T 4: 53,074,233 S1150Y probably damaging Het
Abca13 T A 11: 9,292,595 V1486E probably benign Het
Abca17 T A 17: 24,327,751 Y292F probably damaging Het
Adam3 A G 8: 24,711,675 probably null Het
Ankmy2 G A 12: 36,187,708 E269K probably damaging Het
Cdan1 A G 2: 120,718,921 S1201P probably benign Het
Cep57 T C 9: 13,818,381 Y122C probably damaging Het
Cfh T A 1: 140,086,402 Y1210F probably damaging Het
Cflar T G 1: 58,731,209 L154V probably damaging Het
Chmp4b A G 2: 154,691,242 D134G probably damaging Het
Clec14a A G 12: 58,268,794 F14S possibly damaging Het
Ctnna1 A T 18: 35,152,616 H5L probably benign Het
Cyp2e1 T A 7: 140,763,993 L48Q probably damaging Het
Dnah6 T G 6: 73,087,562 Q2627P possibly damaging Het
Ehmt1 T C 2: 24,840,697 D569G probably damaging Het
Fam129a A G 1: 151,700,107 probably null Het
Frmd4a G A 2: 4,566,112 Het
Fryl T C 5: 73,090,756 D1006G probably damaging Het
Gclm A G 3: 122,262,671 N137D probably benign Het
Gk5 A G 9: 96,179,056 Y531C probably damaging Het
Gpm6a C A 8: 55,037,458 N56K probably benign Het
Grik4 A C 9: 42,543,831 V656G probably damaging Het
Grip2 C A 6: 91,783,569 probably null Het
Gucy2c T C 6: 136,720,766 K636E probably damaging Het
Ifi44l A G 3: 151,759,792 I107T Het
Kif1b T C 4: 149,202,525 T1237A possibly damaging Het
Klk1b11 A G 7: 43,998,962 D131G probably benign Het
Lipe A G 7: 25,385,178 probably null Het
Lrp4 A G 2: 91,511,580 D1846G probably damaging Het
Madd A T 2: 91,155,057 M1273K probably benign Het
Matn3 T A 12: 8,952,472 M228K probably damaging Het
Mterf4 T A 1: 93,304,895 H78L probably benign Het
Ncoa4 T A 14: 32,172,900 L128* probably null Het
Nedd4l A G 18: 65,195,969 N627S probably benign Het
Nphp3 A G 9: 104,041,990 Y1279C probably damaging Het
Nrp1 C A 8: 128,460,712 T413N probably benign Het
Olfr1040 A C 2: 86,146,001 H244Q probably damaging Het
Olfr1205 A T 2: 88,831,386 I90F probably damaging Het
Olfr506 G A 7: 108,613,059 V251I probably damaging Het
Olfr994 A G 2: 85,430,179 Y217H probably damaging Het
Opn4 C A 14: 34,595,877 A267S probably benign Het
Pax3 T C 1: 78,194,011 probably null Het
Pcdha12 A G 18: 37,021,626 E466G probably damaging Het
Pdzk1 A G 3: 96,868,432 E372G probably benign Het
Pigs T A 11: 78,336,739 V243D possibly damaging Het
Pla2g5 C A 4: 138,800,604 C117F probably damaging Het
Ppt2 A G 17: 34,622,855 S236P probably damaging Het
Raver1 T C 9: 21,090,294 D81G probably benign Het
Ryr1 T C 7: 29,103,643 E662G probably damaging Het
Scaf8 G A 17: 3,159,211 V66M probably damaging Het
Scn3a A C 2: 65,464,855 L1508R probably benign Het
Slfn8 T C 11: 83,016,968 R250G probably benign Het
Speer4d A C 5: 15,620,423 T49P probably damaging Het
Spice1 T A 16: 44,355,535 D32E probably damaging Het
Stt3b A G 9: 115,266,156 L269P probably damaging Het
Ttn A G 2: 76,798,112 I14568T possibly damaging Het
U2surp T C 9: 95,485,659 T413A probably benign Het
Ubr3 A G 2: 69,953,705 E755G probably damaging Het
Unc5a A T 13: 54,991,083 S92C probably damaging Het
Zfat T C 15: 68,181,120 Y275C probably damaging Het
Zfp874a A T 13: 67,442,282 S428T probably damaging Het
Zfy1 A G Y: 725,428 V779A probably benign Het
Other mutations in Rpgrip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Rpgrip1 APN 14 52150438 unclassified probably null
IGL01016:Rpgrip1 APN 14 52145836 missense probably damaging 1.00
IGL01019:Rpgrip1 APN 14 52131176 missense possibly damaging 0.70
IGL01382:Rpgrip1 APN 14 52145477 missense possibly damaging 0.93
IGL01433:Rpgrip1 APN 14 52126377 missense probably damaging 1.00
IGL01528:Rpgrip1 APN 14 52112177 nonsense probably null
IGL01548:Rpgrip1 APN 14 52126271 splice site probably benign
IGL01652:Rpgrip1 APN 14 52145492 unclassified probably benign
IGL02040:Rpgrip1 APN 14 52121019 missense possibly damaging 0.86
IGL02113:Rpgrip1 APN 14 52133844 missense possibly damaging 0.85
IGL02121:Rpgrip1 APN 14 52147374 missense possibly damaging 0.89
IGL02185:Rpgrip1 APN 14 52112228 missense possibly damaging 0.72
IGL02234:Rpgrip1 APN 14 52131309 splice site probably benign
IGL02322:Rpgrip1 APN 14 52150042 missense possibly damaging 0.89
IGL02379:Rpgrip1 APN 14 52138888 missense possibly damaging 0.53
IGL02524:Rpgrip1 APN 14 52121054 missense probably benign 0.01
IGL02836:Rpgrip1 APN 14 52145257 unclassified probably null
IGL03264:Rpgrip1 APN 14 52140652 missense possibly damaging 0.53
IGL03410:Rpgrip1 APN 14 52158366 unclassified probably benign
FR4976:Rpgrip1 UTSW 14 52149394 utr 3 prime probably benign
FR4976:Rpgrip1 UTSW 14 52149544 utr 3 prime probably benign
R0045:Rpgrip1 UTSW 14 52141144 missense possibly damaging 0.53
R0045:Rpgrip1 UTSW 14 52141144 missense possibly damaging 0.53
R0089:Rpgrip1 UTSW 14 52149384 utr 3 prime probably benign
R0498:Rpgrip1 UTSW 14 52131314 splice site probably benign
R0602:Rpgrip1 UTSW 14 52133856 missense possibly damaging 0.72
R0776:Rpgrip1 UTSW 14 52141169 missense possibly damaging 0.85
R1139:Rpgrip1 UTSW 14 52147221 missense probably benign 0.33
R1528:Rpgrip1 UTSW 14 52112224 missense probably benign 0.01
R1715:Rpgrip1 UTSW 14 52140691 missense possibly damaging 0.53
R1934:Rpgrip1 UTSW 14 52114644 missense possibly damaging 0.53
R2087:Rpgrip1 UTSW 14 52136622 intron probably null
R2114:Rpgrip1 UTSW 14 52149567 missense probably benign 0.27
R3406:Rpgrip1 UTSW 14 52145209 missense possibly damaging 0.92
R3835:Rpgrip1 UTSW 14 52147253 missense probably damaging 1.00
R4084:Rpgrip1 UTSW 14 52149351 missense possibly damaging 0.72
R4124:Rpgrip1 UTSW 14 52152324 splice site probably null
R4381:Rpgrip1 UTSW 14 52150449 missense possibly damaging 0.54
R4407:Rpgrip1 UTSW 14 52147399 missense probably damaging 1.00
R4520:Rpgrip1 UTSW 14 52152289 missense probably benign 0.08
R4904:Rpgrip1 UTSW 14 52121087 missense possibly damaging 0.86
R4904:Rpgrip1 UTSW 14 52160129 missense probably damaging 0.97
R5284:Rpgrip1 UTSW 14 52149276 missense probably damaging 1.00
R5342:Rpgrip1 UTSW 14 52145209 missense possibly damaging 0.92
R5377:Rpgrip1 UTSW 14 52160195 missense possibly damaging 0.96
R5499:Rpgrip1 UTSW 14 52140585 missense probably benign 0.00
R5729:Rpgrip1 UTSW 14 52160160 missense probably benign 0.28
R5834:Rpgrip1 UTSW 14 52158382 missense probably damaging 0.99
R6157:Rpgrip1 UTSW 14 52112174 missense probably benign 0.00
R6455:Rpgrip1 UTSW 14 52141189 missense probably damaging 0.97
R6796:Rpgrip1 UTSW 14 52150012 missense probably damaging 1.00
R7173:Rpgrip1 UTSW 14 52112176 missense possibly damaging 0.59
R7302:Rpgrip1 UTSW 14 52149555 missense unknown
R7315:Rpgrip1 UTSW 14 52121001 missense not run
R7320:Rpgrip1 UTSW 14 52131216 missense possibly damaging 0.53
R7344:Rpgrip1 UTSW 14 52140659 missense probably damaging 0.98
R7459:Rpgrip1 UTSW 14 52140559 missense probably benign 0.18
R7797:Rpgrip1 UTSW 14 52133820 missense possibly damaging 0.53
R7852:Rpgrip1 UTSW 14 52145880 missense probably benign 0.01
R7935:Rpgrip1 UTSW 14 52145880 missense probably benign 0.01
R8041:Rpgrip1 UTSW 14 52119245 missense possibly damaging 0.53
RF005:Rpgrip1 UTSW 14 52149391 utr 3 prime probably benign
RF028:Rpgrip1 UTSW 14 52149398 nonsense probably null
RF034:Rpgrip1 UTSW 14 52149526 utr 3 prime probably benign
RF035:Rpgrip1 UTSW 14 52149393 utr 3 prime probably benign
RF036:Rpgrip1 UTSW 14 52149541 frame shift probably null
RF040:Rpgrip1 UTSW 14 52149537 frame shift probably null
RF043:Rpgrip1 UTSW 14 52149395 utr 3 prime probably benign
X0024:Rpgrip1 UTSW 14 52141208 missense possibly damaging 0.85
X0026:Rpgrip1 UTSW 14 52147221 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- AGGAGGTCATCAATCTTCCTACTC -3'
(R):5'- GCTGCCCTGTGGAAATTCTC -3'

Sequencing Primer
(F):5'- CCAGCCAGGTCCAGTTTTTAGAG -3'
(R):5'- AAATCAGAGATTTGCACTGAGC -3'
Posted On2019-05-13