Mutagenetix > Incidental Mutation

Incidental Mutation 'R7065:Nedd4l'

548547

Institutional Source

Beutler Lab

Gene Symbol

Nedd4l

Ensembl Gene

ENSMUSG00000024589

Gene Name

neural precursor cell expressed, developmentally down-regulated gene 4-like

Synonyms

Nedd4-2, Nedd4b, 1300012C07Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.201) question?

Stock #

R7065 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

64887705-65217831 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 65195969 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 627 (N627S)

Ref Sequence

ENSEMBL: ENSMUSP00000153526 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080418] [ENSMUST00000163516] [ENSMUST00000224347] [ENSMUST00000226058]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000080418
AA Change: N627S

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000079280
Gene: ENSMUSG00000024589
AA Change: N627S

Domain	Start	End	E-Value	Type
PDB:3M7F\|B	1	64	2e-21	PDB
WW	73	105	2.32e-13	SMART
low complexity region	139	154	N/A	INTRINSIC
low complexity region	166	178	N/A	INTRINSIC
low complexity region	234	247	N/A	INTRINSIC
WW	266	298	2.08e-15	SMART
low complexity region	355	371	N/A	INTRINSIC
WW	378	410	4.1e-14	SMART
WW	429	461	1.53e-13	SMART
HECTc	518	854	3.04e-183	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000163516
AA Change: N748S

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000132838
Gene: ENSMUSG00000024589
AA Change: N748S

Domain	Start	End	E-Value	Type
C2	21	124	1.76e-25	SMART
WW	194	226	2.32e-13	SMART
low complexity region	260	275	N/A	INTRINSIC
low complexity region	287	299	N/A	INTRINSIC
low complexity region	355	368	N/A	INTRINSIC
WW	387	419	2.08e-15	SMART
low complexity region	476	492	N/A	INTRINSIC
WW	499	531	4.1e-14	SMART
WW	550	582	1.53e-13	SMART
HECTc	639	975	3.04e-183	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000224347
AA Change: N607S

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)

Predicted Effect

probably benign
Transcript: ENSMUST00000226058
AA Change: N627S

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein mediates the ubiquitination of multiple target substrates and plays a critical role in epithelial sodium transport by regulating the cell surface expression of the epithelial sodium channel, ENaC. Single nucleotide polymorphisms in this gene may be associated with essential hypertension. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null mutation display salt sensitive hypertension and high salt diet induced cardiac hypertrophy. A spontaneous mutation results in overt diabetes insipidus. Mice homozygous for a knock-out allele exhibit neonatal lethality with primary atelectasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930444G20Rik	T	C	10: 22,067,298	D261G	probably benign	Het
Abca1	G	T	4: 53,074,233	S1150Y	probably damaging	Het
Abca13	T	A	11: 9,292,595	V1486E	probably benign	Het
Abca17	T	A	17: 24,327,751	Y292F	probably damaging	Het
Adam3	A	G	8: 24,711,675		probably null	Het
Ankmy2	G	A	12: 36,187,708	E269K	probably damaging	Het
Cdan1	A	G	2: 120,718,921	S1201P	probably benign	Het
Cep57	T	C	9: 13,818,381	Y122C	probably damaging	Het
Cfh	T	A	1: 140,086,402	Y1210F	probably damaging	Het
Cflar	T	G	1: 58,731,209	L154V	probably damaging	Het
Chmp4b	A	G	2: 154,691,242	D134G	probably damaging	Het
Clec14a	A	G	12: 58,268,794	F14S	possibly damaging	Het
Ctnna1	A	T	18: 35,152,616	H5L	probably benign	Het
Cyp2e1	T	A	7: 140,763,993	L48Q	probably damaging	Het
Dnah6	T	G	6: 73,087,562	Q2627P	possibly damaging	Het
Ehmt1	T	C	2: 24,840,697	D569G	probably damaging	Het
Fam129a	A	G	1: 151,700,107		probably null	Het
Frmd4a	G	A	2: 4,566,112			Het
Fryl	T	C	5: 73,090,756	D1006G	probably damaging	Het
Gclm	A	G	3: 122,262,671	N137D	probably benign	Het
Gk5	A	G	9: 96,179,056	Y531C	probably damaging	Het
Gpm6a	C	A	8: 55,037,458	N56K	probably benign	Het
Grik4	A	C	9: 42,543,831	V656G	probably damaging	Het
Grip2	C	A	6: 91,783,569		probably null	Het
Gucy2c	T	C	6: 136,720,766	K636E	probably damaging	Het
Ifi44l	A	G	3: 151,759,792	I107T		Het
Kif1b	T	C	4: 149,202,525	T1237A	possibly damaging	Het
Klk1b11	A	G	7: 43,998,962	D131G	probably benign	Het
Lipe	A	G	7: 25,385,178		probably null	Het
Lrp4	A	G	2: 91,511,580	D1846G	probably damaging	Het
Madd	A	T	2: 91,155,057	M1273K	probably benign	Het
Matn3	T	A	12: 8,952,472	M228K	probably damaging	Het
Mterf4	T	A	1: 93,304,895	H78L	probably benign	Het
Ncoa4	T	A	14: 32,172,900	L128*	probably null	Het
Nphp3	A	G	9: 104,041,990	Y1279C	probably damaging	Het
Nrp1	C	A	8: 128,460,712	T413N	probably benign	Het
Olfr1040	A	C	2: 86,146,001	H244Q	probably damaging	Het
Olfr1205	A	T	2: 88,831,386	I90F	probably damaging	Het
Olfr506	G	A	7: 108,613,059	V251I	probably damaging	Het
Olfr994	A	G	2: 85,430,179	Y217H	probably damaging	Het
Opn4	C	A	14: 34,595,877	A267S	probably benign	Het
Pax3	T	C	1: 78,194,011		probably null	Het
Pcdha12	A	G	18: 37,021,626	E466G	probably damaging	Het
Pdzk1	A	G	3: 96,868,432	E372G	probably benign	Het
Pigs	T	A	11: 78,336,739	V243D	possibly damaging	Het
Pla2g5	C	A	4: 138,800,604	C117F	probably damaging	Het
Ppt2	A	G	17: 34,622,855	S236P	probably damaging	Het
Raver1	T	C	9: 21,090,294	D81G	probably benign	Het
Rpgrip1	T	C	14: 52,141,193	L525P	possibly damaging	Het
Ryr1	T	C	7: 29,103,643	E662G	probably damaging	Het
Scaf8	G	A	17: 3,159,211	V66M	probably damaging	Het
Scn3a	A	C	2: 65,464,855	L1508R	probably benign	Het
Slfn8	T	C	11: 83,016,968	R250G	probably benign	Het
Speer4d	A	C	5: 15,620,423	T49P	probably damaging	Het
Spice1	T	A	16: 44,355,535	D32E	probably damaging	Het
Stt3b	A	G	9: 115,266,156	L269P	probably damaging	Het
Ttn	A	G	2: 76,798,112	I14568T	possibly damaging	Het
U2surp	T	C	9: 95,485,659	T413A	probably benign	Het
Ubr3	A	G	2: 69,953,705	E755G	probably damaging	Het
Unc5a	A	T	13: 54,991,083	S92C	probably damaging	Het
Zfat	T	C	15: 68,181,120	Y275C	probably damaging	Het
Zfp874a	A	T	13: 67,442,282	S428T	probably damaging	Het
Zfy1	A	G	Y: 725,428	V779A	probably benign	Het

Other mutations in Nedd4l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00501:Nedd4l	APN	18	65208092	missense	probably damaging	1.00
IGL00931:Nedd4l	APN	18	65172399	missense	possibly damaging	0.57
IGL02306:Nedd4l	APN	18	65172954	missense	possibly damaging	0.64
IGL02363:Nedd4l	APN	18	65208045	splice site	probably benign
IGL02440:Nedd4l	APN	18	65163173	critical splice donor site	probably null
IGL02444:Nedd4l	APN	18	65203957	splice site	probably benign
IGL02700:Nedd4l	APN	18	65209680	missense	probably damaging	1.00
IGL02943:Nedd4l	APN	18	65161652	critical splice donor site	probably null
IGL02999:Nedd4l	APN	18	65198707	missense	probably damaging	1.00
IGL03135:Nedd4l	APN	18	65205670	missense	probably damaging	1.00
IGL03373:Nedd4l	APN	18	65181320	splice site	probably benign
R0036:Nedd4l	UTSW	18	65051123	intron	probably benign
R0396:Nedd4l	UTSW	18	65161654	splice site	probably benign
R0472:Nedd4l	UTSW	18	65208461	missense	probably damaging	1.00
R0494:Nedd4l	UTSW	18	65173021	missense	possibly damaging	0.69
R0513:Nedd4l	UTSW	18	65195185	splice site	probably benign
R0609:Nedd4l	UTSW	18	65208461	missense	probably damaging	1.00
R0631:Nedd4l	UTSW	18	65208503	splice site	probably benign
R1077:Nedd4l	UTSW	18	65167499	splice site	probably benign
R1643:Nedd4l	UTSW	18	65198641	missense	probably damaging	1.00
R1722:Nedd4l	UTSW	18	65157939	missense	probably damaging	1.00
R1806:Nedd4l	UTSW	18	65212791	missense	probably damaging	1.00
R1921:Nedd4l	UTSW	18	65167575	critical splice donor site	probably null
R1986:Nedd4l	UTSW	18	65143803	missense	probably damaging	1.00
R2070:Nedd4l	UTSW	18	65212820	missense	probably damaging	1.00
R2151:Nedd4l	UTSW	18	65210330	missense	probably damaging	1.00
R2152:Nedd4l	UTSW	18	65210330	missense	probably damaging	1.00
R2154:Nedd4l	UTSW	18	65210330	missense	probably damaging	1.00
R2358:Nedd4l	UTSW	18	65209719	missense	possibly damaging	0.51
R2680:Nedd4l	UTSW	18	65163130	missense	possibly damaging	0.85
R3082:Nedd4l	UTSW	18	65178978	missense	probably benign	0.00
R3500:Nedd4l	UTSW	18	65212860	missense	probably damaging	1.00
R3711:Nedd4l	UTSW	18	65209719	missense	possibly damaging	0.51
R3712:Nedd4l	UTSW	18	65209719	missense	possibly damaging	0.51
R3874:Nedd4l	UTSW	18	65167535	missense	probably benign
R4435:Nedd4l	UTSW	18	65212825	missense	possibly damaging	0.84
R4698:Nedd4l	UTSW	18	65203880	missense	probably damaging	1.00
R4757:Nedd4l	UTSW	18	65165605	missense	probably damaging	0.98
R4783:Nedd4l	UTSW	18	65172927	missense	probably damaging	0.99
R4790:Nedd4l	UTSW	18	65203945	missense	possibly damaging	0.94
R4980:Nedd4l	UTSW	18	65080060	nonsense	probably null
R5106:Nedd4l	UTSW	18	65193305	missense	probably damaging	1.00
R5122:Nedd4l	UTSW	18	65191447	missense	probably damaging	1.00
R5605:Nedd4l	UTSW	18	65174244	critical splice donor site	probably null
R6465:Nedd4l	UTSW	18	65155264	missense	probably benign	0.06
R6479:Nedd4l	UTSW	18	65209681	missense	probably damaging	1.00
R6622:Nedd4l	UTSW	18	65174234	missense	probably damaging	0.99
R6773:Nedd4l	UTSW	18	65167551	missense	probably benign	0.36
R7068:Nedd4l	UTSW	18	65205651	missense	probably damaging	1.00
R7193:Nedd4l	UTSW	18	64997370	missense	probably damaging	1.00
R7496:Nedd4l	UTSW	18	65080018	missense	possibly damaging	0.94
R7903:Nedd4l	UTSW	18	65186367	missense	probably damaging	1.00
R8123:Nedd4l	UTSW	18	65074774	missense	probably damaging	1.00
R8185:Nedd4l	UTSW	18	65209698	missense	probably damaging	1.00
R8282:Nedd4l	UTSW	18	65191489	missense	probably damaging	0.98
R8440:Nedd4l	UTSW	18	64889055	splice site	probably null
R8499:Nedd4l	UTSW	18	65209657	missense	probably damaging	0.98
R8557:Nedd4l	UTSW	18	65203915	missense	probably benign	0.00
R8801:Nedd4l	UTSW	18	65155275	missense	probably damaging	1.00
R8896:Nedd4l	UTSW	18	65165617	missense	probably benign
R9025:Nedd4l	UTSW	18	65178924	missense	probably damaging	0.98
R9040:Nedd4l	UTSW	18	65209663	missense	probably damaging	0.99
R9482:Nedd4l	UTSW	18	64887960	unclassified	probably benign
R9498:Nedd4l	UTSW	18	65161652	critical splice donor site	probably null
R9599:Nedd4l	UTSW	18	65210329	missense	probably damaging	1.00
RF013:Nedd4l	UTSW	18	65209680	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCAGGACATGAGAATTGAGGACTC -3'
(R):5'- TTCAAGCAAGCGATTCCTCC -3'

Sequencing Primer
(F):5'- TCATGGGTTACTGCACCAG -3'
(R):5'- CCTCTTGTTCATGTGAAGTACCTATG -3'

Posted On

2019-05-13