Incidental Mutation 'R7066:Olfr1086'
ID548553
Institutional Source Beutler Lab
Gene Symbol Olfr1086
Ensembl Gene ENSMUSG00000075175
Gene Nameolfactory receptor 1086
SynonymsGA_x6K02T2Q125-48168771-48167839, MOR179-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R7066 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location86676218-86680092 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86677226 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 36 (T36S)
Ref Sequence ENSEMBL: ENSMUSP00000150094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099878] [ENSMUST00000213198]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099878
AA Change: T36S

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097463
Gene: ENSMUSG00000075175
AA Change: T36S

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 3.3e-49 PFAM
Pfam:7tm_1 39 288 1.4e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213198
AA Change: T36S

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T C 19: 31,927,114 V175A probably damaging Het
Adamts5 A T 16: 85,862,764 V880E probably damaging Het
Adgrf1 T A 17: 43,310,260 F463I probably benign Het
Ano1 T A 7: 144,637,086 E249D probably benign Het
Aoc1 A G 6: 48,908,619 D686G probably damaging Het
Cacna1d A T 14: 30,352,978 probably benign Het
Cdc42ep4 A G 11: 113,729,218 S116P probably damaging Het
Ces2a T C 8: 104,740,248 V463A probably damaging Het
Depdc5 A G 5: 32,901,848 D297G probably benign Het
Fsip2 T A 2: 82,990,891 V5656E possibly damaging Het
Gbp5 A G 3: 142,507,729 T469A probably benign Het
Gm21663 C G 5: 25,941,261 probably null Het
Iqch A G 9: 63,524,745 V456A probably benign Het
Lpcat1 A C 13: 73,511,381 I373L probably benign Het
Morc2b C T 17: 33,136,636 V721I probably benign Het
Mrgprb1 C T 7: 48,447,676 V163M probably benign Het
Mtfr2 A G 10: 20,354,226 I142V possibly damaging Het
Muc16 A T 9: 18,658,021 S1067R unknown Het
Myh14 T C 7: 44,630,755 S892G possibly damaging Het
Mylk2 C T 2: 152,911,668 probably null Het
Mzf1 A T 7: 13,043,563 V638E possibly damaging Het
Ncoa1 C T 12: 4,322,934 V156I possibly damaging Het
Nf1 A G 11: 79,556,720 E2450G probably damaging Het
Olfr1048 T C 2: 86,236,658 D52G probably damaging Het
Olfr114 T A 17: 37,590,143 D70V probably damaging Het
Olfr1245 T C 2: 89,575,703 T8A probably damaging Het
Olfr1313 G A 2: 112,072,196 P129L probably damaging Het
Olfr389 A G 11: 73,777,192 I45T probably damaging Het
Olfr794 T C 10: 129,571,504 L283S probably damaging Het
Olfr969 A G 9: 39,796,124 I250V probably benign Het
P4htm T G 9: 108,596,963 K125N probably damaging Het
Patj A G 4: 98,413,197 T240A probably benign Het
Pcolce2 T C 9: 95,681,621 V220A probably benign Het
Pcyox1 A T 6: 86,394,496 I136N probably damaging Het
Pde4b A G 4: 102,602,806 S395G probably benign Het
Peg3 C A 7: 6,708,857 R1122L probably damaging Het
Plekhm1 A G 11: 103,370,988 V922A possibly damaging Het
Rad51c T C 11: 87,402,676 N118S possibly damaging Het
Rb1cc1 T A 1: 6,250,005 V1216D possibly damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rlf T C 4: 121,148,787 M999V probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,918 probably benign Het
Samd7 G C 3: 30,751,123 K18N probably benign Het
Sema5b A C 16: 35,651,312 D425A probably benign Het
Siglecg A G 7: 43,411,742 E413G probably benign Het
Tcaf1 A T 6: 42,679,177 N288K probably damaging Het
Tdp1 A G 12: 99,894,732 D210G probably benign Het
Umps A T 16: 33,961,733 L273* probably null Het
Vcan A T 13: 89,705,686 V385D probably damaging Het
Wdr59 T C 8: 111,465,845 T676A probably benign Het
Zdbf2 A G 1: 63,307,559 H1699R probably benign Het
Zfp27 AATCCGCTTGTGCA AA 7: 29,895,021 probably benign Het
Other mutations in Olfr1086
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01783:Olfr1086 APN 2 86677081 missense probably benign 0.00
R0492:Olfr1086 UTSW 2 86676490 missense probably damaging 1.00
R0629:Olfr1086 UTSW 2 86676529 missense possibly damaging 0.65
R1114:Olfr1086 UTSW 2 86677285 missense possibly damaging 0.72
R1341:Olfr1086 UTSW 2 86677163 missense possibly damaging 0.86
R1868:Olfr1086 UTSW 2 86677285 missense possibly damaging 0.72
R2183:Olfr1086 UTSW 2 86677036 missense probably benign 0.21
R3159:Olfr1086 UTSW 2 86676511 missense probably benign 0.03
R4061:Olfr1086 UTSW 2 86676818 missense probably damaging 1.00
R4420:Olfr1086 UTSW 2 86676919 missense possibly damaging 0.95
R5514:Olfr1086 UTSW 2 86676881 missense probably benign 0.03
R7077:Olfr1086 UTSW 2 86676892 missense possibly damaging 0.78
R7246:Olfr1086 UTSW 2 86677289 missense probably benign 0.11
R7383:Olfr1086 UTSW 2 86676919 missense possibly damaging 0.95
R8062:Olfr1086 UTSW 2 86677066 missense probably benign 0.01
X0064:Olfr1086 UTSW 2 86677199 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCCAGAAACATCTGTGTGGC -3'
(R):5'- GCACAGCTCACCTCATTCAGAG -3'

Sequencing Primer
(F):5'- CACAGCCAATGAATGAAATGACTTTC -3'
(R):5'- TCACCTCATTCAGAGCAAAAATACTG -3'
Posted On2019-05-13