Incidental Mutation 'R7066:Patj'
ID548558
Institutional Source Beutler Lab
Gene Symbol Patj
Ensembl Gene ENSMUSG00000061859
Gene NamePATJ, crumbs cell polarity complex component
SynonymsInadl, Cipp
MMRRC Submission
Accession Numbers

Genbank: NM_172696; MGI: 1277960

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7066 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location98395785-98719603 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98413197 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 240 (T240A)
Ref Sequence ENSEMBL: ENSMUSP00000102645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041284] [ENSMUST00000107030] [ENSMUST00000107033] [ENSMUST00000107034]
PDB Structure Overall structure of Patj/Pals1/Mals complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000041284
AA Change: T240A

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000049176
Gene: ENSMUSG00000061859
AA Change: T240A

DomainStartEndE-ValueType
L27 8 68 6.53e-9 SMART
PDZ 143 221 1.78e-20 SMART
PDZ 256 328 1.15e-23 SMART
PDZ 374 453 3.15e-21 SMART
coiled coil region 486 513 N/A INTRINSIC
PDZ 570 641 1.28e-12 SMART
PDZ 696 775 9.5e-16 SMART
low complexity region 980 991 N/A INTRINSIC
low complexity region 1054 1062 N/A INTRINSIC
PDZ 1083 1166 8.65e-19 SMART
PDZ 1253 1328 6.12e-19 SMART
low complexity region 1356 1366 N/A INTRINSIC
low complexity region 1410 1428 N/A INTRINSIC
PDZ 1480 1555 4.36e-24 SMART
PDZ 1577 1650 2.49e-19 SMART
PDZ 1718 1795 2.13e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107030
AA Change: T240A

PolyPhen 2 Score 0.243 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000102645
Gene: ENSMUSG00000061859
AA Change: T240A

DomainStartEndE-ValueType
L27 8 68 6.53e-9 SMART
PDZ 143 221 1.78e-20 SMART
PDZ 256 328 1.15e-23 SMART
PDZ 374 453 3.15e-21 SMART
coiled coil region 486 513 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107033
AA Change: T240A

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000102648
Gene: ENSMUSG00000061859
AA Change: T240A

DomainStartEndE-ValueType
L27 8 68 6.53e-9 SMART
PDZ 143 221 1.78e-20 SMART
PDZ 256 328 1.15e-23 SMART
PDZ 374 453 3.15e-21 SMART
coiled coil region 486 513 N/A INTRINSIC
low complexity region 648 659 N/A INTRINSIC
low complexity region 722 730 N/A INTRINSIC
PDZ 751 834 8.65e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107034
AA Change: T240A

PolyPhen 2 Score 0.157 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000102649
Gene: ENSMUSG00000061859
AA Change: T240A

DomainStartEndE-ValueType
L27 8 68 6.53e-9 SMART
PDZ 143 221 1.78e-20 SMART
PDZ 256 328 1.15e-23 SMART
PDZ 374 453 3.15e-21 SMART
coiled coil region 486 513 N/A INTRINSIC
PDZ 566 637 1.28e-12 SMART
PDZ 692 771 9.5e-16 SMART
low complexity region 976 987 N/A INTRINSIC
low complexity region 1050 1058 N/A INTRINSIC
PDZ 1079 1162 8.65e-19 SMART
PDZ 1249 1324 6.12e-19 SMART
low complexity region 1352 1362 N/A INTRINSIC
low complexity region 1382 1400 N/A INTRINSIC
PDZ 1452 1499 7.78e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: This gene encodes a multivalent PDZ domain protein, which is expressed exclusively in brain and kidney. This protein selectively interacts with inward rectifier K+ (Kir) family members, N-methyl-D-aspartate receptor subunits, neurexins and neuroligins, as well as cell surface molecules enriched in synaptic membranes. Thus, this protein may serve as a scaffold that brings structurally diverse but functionally connected proteins into close proximity at the synapse. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T C 19: 31,927,114 V175A probably damaging Het
Adamts5 A T 16: 85,862,764 V880E probably damaging Het
Adgrf1 T A 17: 43,310,260 F463I probably benign Het
Ano1 T A 7: 144,637,086 E249D probably benign Het
Aoc1 A G 6: 48,908,619 D686G probably damaging Het
Cacna1d A T 14: 30,352,978 probably benign Het
Cdc42ep4 A G 11: 113,729,218 S116P probably damaging Het
Ces2a T C 8: 104,740,248 V463A probably damaging Het
Depdc5 A G 5: 32,901,848 D297G probably benign Het
Fsip2 T A 2: 82,990,891 V5656E possibly damaging Het
Gbp5 A G 3: 142,507,729 T469A probably benign Het
Gm21663 C G 5: 25,941,261 probably null Het
Iqch A G 9: 63,524,745 V456A probably benign Het
Lpcat1 A C 13: 73,511,381 I373L probably benign Het
Morc2b C T 17: 33,136,636 V721I probably benign Het
Mrgprb1 C T 7: 48,447,676 V163M probably benign Het
Mtfr2 A G 10: 20,354,226 I142V possibly damaging Het
Muc16 A T 9: 18,658,021 S1067R unknown Het
Myh14 T C 7: 44,630,755 S892G possibly damaging Het
Mylk2 C T 2: 152,911,668 probably null Het
Mzf1 A T 7: 13,043,563 V638E possibly damaging Het
Ncoa1 C T 12: 4,322,934 V156I possibly damaging Het
Nf1 A G 11: 79,556,720 E2450G probably damaging Het
Olfr1048 T C 2: 86,236,658 D52G probably damaging Het
Olfr1086 T A 2: 86,677,226 T36S possibly damaging Het
Olfr114 T A 17: 37,590,143 D70V probably damaging Het
Olfr1245 T C 2: 89,575,703 T8A probably damaging Het
Olfr1313 G A 2: 112,072,196 P129L probably damaging Het
Olfr389 A G 11: 73,777,192 I45T probably damaging Het
Olfr794 T C 10: 129,571,504 L283S probably damaging Het
Olfr969 A G 9: 39,796,124 I250V probably benign Het
P4htm T G 9: 108,596,963 K125N probably damaging Het
Pcolce2 T C 9: 95,681,621 V220A probably benign Het
Pcyox1 A T 6: 86,394,496 I136N probably damaging Het
Pde4b A G 4: 102,602,806 S395G probably benign Het
Peg3 C A 7: 6,708,857 R1122L probably damaging Het
Plekhm1 A G 11: 103,370,988 V922A possibly damaging Het
Rad51c T C 11: 87,402,676 N118S possibly damaging Het
Rb1cc1 T A 1: 6,250,005 V1216D possibly damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rlf T C 4: 121,148,787 M999V probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,918 probably benign Het
Samd7 G C 3: 30,751,123 K18N probably benign Het
Sema5b A C 16: 35,651,312 D425A probably benign Het
Siglecg A G 7: 43,411,742 E413G probably benign Het
Tcaf1 A T 6: 42,679,177 N288K probably damaging Het
Tdp1 A G 12: 99,894,732 D210G probably benign Het
Umps A T 16: 33,961,733 L273* probably null Het
Vcan A T 13: 89,705,686 V385D probably damaging Het
Wdr59 T C 8: 111,465,845 T676A probably benign Het
Zdbf2 A G 1: 63,307,559 H1699R probably benign Het
Zfp27 AATCCGCTTGTGCA AA 7: 29,895,021 probably benign Het
Other mutations in Patj
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Patj APN 4 98465106 missense probably damaging 1.00
IGL00095:Patj APN 4 98535562 missense possibly damaging 0.78
IGL00517:Patj APN 4 98441071 missense possibly damaging 0.95
IGL00802:Patj APN 4 98424406 missense possibly damaging 0.93
IGL01064:Patj APN 4 98496973 missense possibly damaging 0.95
IGL01110:Patj APN 4 98413024 missense probably damaging 0.99
IGL01407:Patj APN 4 98413050 missense possibly damaging 0.49
IGL01821:Patj APN 4 98456211 missense probably damaging 1.00
IGL02399:Patj APN 4 98591936 missense probably damaging 1.00
IGL02494:Patj APN 4 98703987 splice site probably benign
IGL02803:Patj APN 4 98426064 missense probably damaging 0.99
IGL02931:Patj APN 4 98411173 splice site probably benign
IGL03017:Patj APN 4 98465027 splice site probably benign
IGL03115:Patj APN 4 98443803 missense probably damaging 1.00
IGL03209:Patj APN 4 98465140 missense probably null 1.00
IGL03377:Patj APN 4 98465104 missense probably damaging 1.00
D4186:Patj UTSW 4 98638762 missense probably benign 0.17
PIT4531001:Patj UTSW 4 98441090 missense probably damaging 0.98
R0136:Patj UTSW 4 98667648 missense probably damaging 1.00
R0294:Patj UTSW 4 98497048 missense probably damaging 0.99
R0376:Patj UTSW 4 98568987 missense probably damaging 1.00
R0463:Patj UTSW 4 98674308 missense probably damaging 1.00
R0465:Patj UTSW 4 98535507 splice site probably null
R0466:Patj UTSW 4 98688156 missense probably damaging 1.00
R0544:Patj UTSW 4 98569110 missense probably damaging 1.00
R0624:Patj UTSW 4 98681235 splice site probably benign
R0657:Patj UTSW 4 98667648 missense probably damaging 1.00
R1281:Patj UTSW 4 98416695 missense probably damaging 1.00
R1393:Patj UTSW 4 98424411 missense probably benign 0.01
R1480:Patj UTSW 4 98469582 missense probably damaging 1.00
R1667:Patj UTSW 4 98413027 missense probably damaging 1.00
R1728:Patj UTSW 4 98431780 missense possibly damaging 0.50
R1729:Patj UTSW 4 98431780 missense possibly damaging 0.50
R1797:Patj UTSW 4 98687438 missense probably damaging 1.00
R1818:Patj UTSW 4 98623648 missense possibly damaging 0.85
R1835:Patj UTSW 4 98491590 missense probably benign 0.00
R1880:Patj UTSW 4 98497240 missense probably benign 0.00
R2009:Patj UTSW 4 98456169 missense probably damaging 1.00
R2090:Patj UTSW 4 98437323 unclassified probably benign
R2120:Patj UTSW 4 98456225 missense probably benign 0.01
R2180:Patj UTSW 4 98523502 critical splice donor site probably null
R2655:Patj UTSW 4 98437450 missense possibly damaging 0.64
R3156:Patj UTSW 4 98674228 missense probably damaging 1.00
R3749:Patj UTSW 4 98469600 missense probably damaging 1.00
R3767:Patj UTSW 4 98681219 nonsense probably null
R3913:Patj UTSW 4 98569101 missense probably damaging 0.99
R3917:Patj UTSW 4 98592008 nonsense probably null
R3918:Patj UTSW 4 98456218 missense probably damaging 1.00
R4299:Patj UTSW 4 98677321 missense possibly damaging 0.89
R4355:Patj UTSW 4 98650454 missense possibly damaging 0.87
R4471:Patj UTSW 4 98535579 missense probably damaging 1.00
R4762:Patj UTSW 4 98405570 nonsense probably null
R4877:Patj UTSW 4 98569058 missense possibly damaging 0.94
R4945:Patj UTSW 4 98495064 missense probably damaging 0.97
R5274:Patj UTSW 4 98518981 missense probably damaging 0.99
R5343:Patj UTSW 4 98676193 missense probably damaging 1.00
R5554:Patj UTSW 4 98454396 missense possibly damaging 0.79
R5688:Patj UTSW 4 98520810 nonsense probably null
R5880:Patj UTSW 4 98411145 missense probably damaging 0.96
R5972:Patj UTSW 4 98569053 missense probably damaging 0.98
R6149:Patj UTSW 4 98424325 missense possibly damaging 0.72
R6192:Patj UTSW 4 98456157 missense probably damaging 1.00
R6265:Patj UTSW 4 98469567 missense probably benign 0.08
R6350:Patj UTSW 4 98405618 missense probably benign 0.26
R6363:Patj UTSW 4 98431860 missense probably benign 0.25
R6434:Patj UTSW 4 98491629 missense probably damaging 1.00
R6496:Patj UTSW 4 98416752 missense probably damaging 1.00
R6896:Patj UTSW 4 98426050 missense possibly damaging 0.87
R7039:Patj UTSW 4 98569078 missense probably damaging 0.96
R7040:Patj UTSW 4 98441080 missense probably benign 0.02
R7052:Patj UTSW 4 98677260 missense probably benign 0.03
R7236:Patj UTSW 4 98411057 missense probably damaging 1.00
R7242:Patj UTSW 4 98591933 missense probably benign 0.26
R7260:Patj UTSW 4 98416733 missense possibly damaging 0.94
R7412:Patj UTSW 4 98411139 missense probably damaging 0.98
R7493:Patj UTSW 4 98495061 missense probably benign 0.41
R7570:Patj UTSW 4 98424500 splice site probably null
R7571:Patj UTSW 4 98568980 missense probably damaging 1.00
R7626:Patj UTSW 4 98546987 missense probably benign 0.35
R7658:Patj UTSW 4 98688179 missense probably damaging 1.00
R7664:Patj UTSW 4 98496950 missense possibly damaging 0.92
R7669:Patj UTSW 4 98518942 missense probably damaging 1.00
R7796:Patj UTSW 4 98546983 start codon destroyed probably benign 0.05
R7870:Patj UTSW 4 98424316 missense probably damaging 1.00
R7883:Patj UTSW 4 98611135 missense probably benign 0.00
R7948:Patj UTSW 4 98424310 missense probably damaging 0.99
R8050:Patj UTSW 4 98538964 missense probably benign 0.00
R8483:Patj UTSW 4 98424302 missense probably damaging 1.00
R8546:Patj UTSW 4 98437397 missense probably benign 0.00
R8746:Patj UTSW 4 98505830 intron probably benign
R8844:Patj UTSW 4 98591969 missense probably damaging 1.00
R8905:Patj UTSW 4 98497175 missense probably damaging 1.00
R8912:Patj UTSW 4 98497328 missense
R8959:Patj UTSW 4 98591975 missense probably damaging 0.99
Z1176:Patj UTSW 4 98611130 missense probably benign 0.11
Z1176:Patj UTSW 4 98676318 nonsense probably null
Z1177:Patj UTSW 4 98497174 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGTTAGGGATCACAGATTGAAGG -3'
(R):5'- GGACTATATAACAGGTGTCCCC -3'

Sequencing Primer
(F):5'- TCACAGATTGAAGGAAAATGACC -3'
(R):5'- GACTATATAACAGGTGTCCCCTTTTC -3'
Posted On2019-05-13