Incidental Mutation 'R7066:Aoc1'
ID548563
Institutional Source Beutler Lab
Gene Symbol Aoc1
Ensembl Gene ENSMUSG00000029811
Gene Nameamine oxidase, copper-containing 1
SynonymsAbp1, 1600012D06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7066 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location48872896-48909188 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 48908619 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 686 (D686G)
Ref Sequence ENSEMBL: ENSMUSP00000128816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031835] [ENSMUST00000162948] [ENSMUST00000167529] [ENSMUST00000204856]
Predicted Effect probably damaging
Transcript: ENSMUST00000031835
AA Change: D686G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031835
Gene: ENSMUSG00000029811
AA Change: D686G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 44 130 8.8e-26 PFAM
Pfam:Cu_amine_oxidN3 146 246 4.1e-20 PFAM
low complexity region 259 274 N/A INTRINSIC
Pfam:Cu_amine_oxid 305 720 6.1e-132 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162948
AA Change: D686G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124085
Gene: ENSMUSG00000029811
AA Change: D686G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 44 130 8.8e-26 PFAM
Pfam:Cu_amine_oxidN3 146 246 4.1e-20 PFAM
low complexity region 259 274 N/A INTRINSIC
Pfam:Cu_amine_oxid 305 720 6.1e-132 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167529
AA Change: D686G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128816
Gene: ENSMUSG00000029811
AA Change: D686G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 44 130 2.4e-30 PFAM
Pfam:Cu_amine_oxidN3 146 246 1.5e-23 PFAM
low complexity region 259 274 N/A INTRINSIC
Pfam:Cu_amine_oxid 305 717 1.5e-123 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204856
SMART Domains Protein: ENSMUSP00000144764
Gene: ENSMUSG00000029811

DomainStartEndE-ValueType
signal peptide 1 49 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 66 152 4.3e-28 PFAM
Pfam:Cu_amine_oxidN3 168 250 8.9e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a metal-binding membrane glycoprotein that oxidatively deaminates putrescine, histamine, and related compounds. The encoded protein is inhibited by amiloride, a diuretic that acts by closing epithelial sodium ion channels. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T C 19: 31,927,114 V175A probably damaging Het
Adamts5 A T 16: 85,862,764 V880E probably damaging Het
Adgrf1 T A 17: 43,310,260 F463I probably benign Het
Ano1 T A 7: 144,637,086 E249D probably benign Het
Cacna1d A T 14: 30,352,978 probably benign Het
Cdc42ep4 A G 11: 113,729,218 S116P probably damaging Het
Ces2a T C 8: 104,740,248 V463A probably damaging Het
Depdc5 A G 5: 32,901,848 D297G probably benign Het
Fsip2 T A 2: 82,990,891 V5656E possibly damaging Het
Gbp5 A G 3: 142,507,729 T469A probably benign Het
Gm21663 C G 5: 25,941,261 probably null Het
Iqch A G 9: 63,524,745 V456A probably benign Het
Lpcat1 A C 13: 73,511,381 I373L probably benign Het
Morc2b C T 17: 33,136,636 V721I probably benign Het
Mrgprb1 C T 7: 48,447,676 V163M probably benign Het
Mtfr2 A G 10: 20,354,226 I142V possibly damaging Het
Muc16 A T 9: 18,658,021 S1067R unknown Het
Myh14 T C 7: 44,630,755 S892G possibly damaging Het
Mylk2 C T 2: 152,911,668 probably null Het
Mzf1 A T 7: 13,043,563 V638E possibly damaging Het
Ncoa1 C T 12: 4,322,934 V156I possibly damaging Het
Nf1 A G 11: 79,556,720 E2450G probably damaging Het
Olfr1048 T C 2: 86,236,658 D52G probably damaging Het
Olfr1086 T A 2: 86,677,226 T36S possibly damaging Het
Olfr114 T A 17: 37,590,143 D70V probably damaging Het
Olfr1245 T C 2: 89,575,703 T8A probably damaging Het
Olfr1313 G A 2: 112,072,196 P129L probably damaging Het
Olfr389 A G 11: 73,777,192 I45T probably damaging Het
Olfr794 T C 10: 129,571,504 L283S probably damaging Het
Olfr969 A G 9: 39,796,124 I250V probably benign Het
P4htm T G 9: 108,596,963 K125N probably damaging Het
Patj A G 4: 98,413,197 T240A probably benign Het
Pcolce2 T C 9: 95,681,621 V220A probably benign Het
Pcyox1 A T 6: 86,394,496 I136N probably damaging Het
Pde4b A G 4: 102,602,806 S395G probably benign Het
Peg3 C A 7: 6,708,857 R1122L probably damaging Het
Plekhm1 A G 11: 103,370,988 V922A possibly damaging Het
Rad51c T C 11: 87,402,676 N118S possibly damaging Het
Rb1cc1 T A 1: 6,250,005 V1216D possibly damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rlf T C 4: 121,148,787 M999V probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,918 probably benign Het
Samd7 G C 3: 30,751,123 K18N probably benign Het
Sema5b A C 16: 35,651,312 D425A probably benign Het
Siglecg A G 7: 43,411,742 E413G probably benign Het
Tcaf1 A T 6: 42,679,177 N288K probably damaging Het
Tdp1 A G 12: 99,894,732 D210G probably benign Het
Umps A T 16: 33,961,733 L273* probably null Het
Vcan A T 13: 89,705,686 V385D probably damaging Het
Wdr59 T C 8: 111,465,845 T676A probably benign Het
Zdbf2 A G 1: 63,307,559 H1699R probably benign Het
Zfp27 AATCCGCTTGTGCA AA 7: 29,895,021 probably benign Het
Other mutations in Aoc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Aoc1 APN 6 48908664 missense possibly damaging 0.92
IGL01115:Aoc1 APN 6 48906197 missense probably damaging 1.00
IGL01626:Aoc1 APN 6 48906531 missense probably damaging 1.00
IGL01891:Aoc1 APN 6 48908842 unclassified probably benign
IGL01908:Aoc1 APN 6 48906756 missense probably damaging 1.00
IGL01919:Aoc1 APN 6 48908289 missense probably damaging 1.00
IGL01960:Aoc1 APN 6 48908603 missense probably benign 0.00
IGL02102:Aoc1 APN 6 48905962 missense probably damaging 0.99
IGL02121:Aoc1 APN 6 48906320 splice site probably null
IGL02229:Aoc1 APN 6 48905909 nonsense probably null
IGL02325:Aoc1 APN 6 48905895 missense possibly damaging 0.46
IGL02626:Aoc1 APN 6 48906110 missense probably benign 0.04
IGL02737:Aoc1 APN 6 48907643 missense probably benign 0.01
IGL03244:Aoc1 APN 6 48905822 missense possibly damaging 0.79
IGL03371:Aoc1 APN 6 48906446 missense probably benign 0.05
R0100:Aoc1 UTSW 6 48908604 missense possibly damaging 0.92
R0835:Aoc1 UTSW 6 48905514 missense probably damaging 1.00
R1240:Aoc1 UTSW 6 48905615 missense probably benign 0.10
R1400:Aoc1 UTSW 6 48906283 nonsense probably null
R1400:Aoc1 UTSW 6 48906711 missense probably benign
R1443:Aoc1 UTSW 6 48905445 missense possibly damaging 0.95
R1447:Aoc1 UTSW 6 48906242 missense probably benign 0.00
R1572:Aoc1 UTSW 6 48905786 missense possibly damaging 0.48
R1850:Aoc1 UTSW 6 48905268 missense probably benign 0.19
R2008:Aoc1 UTSW 6 48905897 missense probably damaging 1.00
R2256:Aoc1 UTSW 6 48906440 missense possibly damaging 0.95
R3429:Aoc1 UTSW 6 48906076 missense probably benign
R3430:Aoc1 UTSW 6 48906076 missense probably benign
R3432:Aoc1 UTSW 6 48905844 missense probably damaging 1.00
R3783:Aoc1 UTSW 6 48905655 missense probably damaging 1.00
R3786:Aoc1 UTSW 6 48905655 missense probably damaging 1.00
R3787:Aoc1 UTSW 6 48905655 missense probably damaging 1.00
R4024:Aoc1 UTSW 6 48908269 missense probably damaging 1.00
R4025:Aoc1 UTSW 6 48908269 missense probably damaging 1.00
R4455:Aoc1 UTSW 6 48905467 missense probably damaging 0.98
R4510:Aoc1 UTSW 6 48907806 missense probably damaging 0.99
R4511:Aoc1 UTSW 6 48907806 missense probably damaging 0.99
R4525:Aoc1 UTSW 6 48906675 missense probably damaging 1.00
R4659:Aoc1 UTSW 6 48906076 missense probably benign
R4876:Aoc1 UTSW 6 48906747 missense possibly damaging 0.78
R5150:Aoc1 UTSW 6 48906150 missense possibly damaging 0.88
R5153:Aoc1 UTSW 6 48908747 missense probably benign 0.19
R5437:Aoc1 UTSW 6 48907750 missense probably benign 0.00
R6000:Aoc1 UTSW 6 48907639 missense probably benign 0.05
R6112:Aoc1 UTSW 6 48908691 missense probably damaging 1.00
R6195:Aoc1 UTSW 6 48908677 missense probably damaging 1.00
R6252:Aoc1 UTSW 6 48906081 missense probably benign 0.01
R6703:Aoc1 UTSW 6 48905714 missense probably damaging 1.00
R6748:Aoc1 UTSW 6 48906294 missense possibly damaging 0.84
R6765:Aoc1 UTSW 6 48905937 missense probably benign 0.00
R6935:Aoc1 UTSW 6 48908227 missense probably damaging 1.00
R7002:Aoc1 UTSW 6 48905876 missense probably benign
R7120:Aoc1 UTSW 6 48906597 missense probably damaging 1.00
R7234:Aoc1 UTSW 6 48905816 nonsense probably null
R7362:Aoc1 UTSW 6 48905411 missense probably benign 0.18
R7452:Aoc1 UTSW 6 48908790 missense probably benign 0.11
R7618:Aoc1 UTSW 6 48906386 missense possibly damaging 0.71
R7773:Aoc1 UTSW 6 48906212 missense probably benign 0.00
R7821:Aoc1 UTSW 6 48905811 missense probably damaging 1.00
R7837:Aoc1 UTSW 6 48905650 nonsense probably null
R8010:Aoc1 UTSW 6 48905648 missense probably benign 0.40
R8517:Aoc1 UTSW 6 48906710 nonsense probably null
R8774:Aoc1 UTSW 6 48908595 missense probably damaging 1.00
R8774-TAIL:Aoc1 UTSW 6 48908595 missense probably damaging 1.00
R8853:Aoc1 UTSW 6 48906060 missense probably benign 0.00
X0066:Aoc1 UTSW 6 48908252 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACCTCTCCAATGGAACTG -3'
(R):5'- CATCACACAGGCTTGTAGGTC -3'

Sequencing Primer
(F):5'- CTCCAATGGAACTGAGAGCATCTTG -3'
(R):5'- ACACAGGCTTGTAGGTCCCATTG -3'
Posted On2019-05-13