Incidental Mutation 'R7066:Peg3'
ID 548565
Institutional Source Beutler Lab
Gene Symbol Peg3
Ensembl Gene ENSMUSG00000002265
Gene Name paternally expressed 3
Synonyms Zfp102, Gcap4, Pw1, End4
MMRRC Submission
Accession Numbers

Genbank: NM_008817; MGI: 104748

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7066 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 6703892-6730431 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 6708857 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 1122 (R1122L)
Ref Sequence ENSEMBL: ENSMUSP00000050750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051209] [ENSMUST00000143703] [ENSMUST00000150182]
AlphaFold Q3URU2
Predicted Effect probably damaging
Transcript: ENSMUST00000051209
AA Change: R1122L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000050750
Gene: ENSMUSG00000002265
AA Change: R1122L

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
low complexity region 213 221 N/A INTRINSIC
ZnF_C2H2 325 347 7.26e-3 SMART
ZnF_C2H2 378 400 6.88e-4 SMART
ZnF_C2H2 436 458 2.95e-3 SMART
low complexity region 464 496 N/A INTRINSIC
ZnF_C2H2 520 542 5.99e-4 SMART
low complexity region 691 698 N/A INTRINSIC
ZnF_C2H2 850 872 2.99e-4 SMART
ZnF_C2H2 1091 1113 2.05e-2 SMART
ZnF_C2H2 1147 1169 1.04e-3 SMART
ZnF_C2H2 1209 1231 1.38e-3 SMART
ZnF_C2H2 1266 1289 1.89e-1 SMART
ZnF_C2H2 1317 1339 1.57e2 SMART
low complexity region 1373 1419 N/A INTRINSIC
low complexity region 1440 1486 N/A INTRINSIC
ZnF_C2H2 1488 1510 2.2e-2 SMART
ZnF_C2H2 1547 1569 1.38e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143703
SMART Domains Protein: ENSMUSP00000122423
Gene: ENSMUSG00000002265

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150182
SMART Domains Protein: ENSMUSP00000116161
Gene: ENSMUSG00000002265

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
Meta Mutation Damage Score 0.2631 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In human, ZIM2 and PEG3 are treated as two distinct genes though they share multiple 5' exons and a common promoter and both genes are paternally expressed (PMID:15203203). Alternative splicing events connect their shared 5' exons either with the remaining 4 exons unique to ZIM2, or with the remaining 2 exons unique to PEG3. In contrast, in other mammals ZIM2 does not undergo imprinting and, in mouse, cow, and likely other mammals as well, the ZIM2 and PEG3 genes do not share exons. Human PEG3 protein belongs to the Kruppel C2H2-type zinc finger protein family. PEG3 may play a role in cell proliferation and p53-mediated apoptosis. PEG3 has also shown tumor suppressor activity and tumorigenesis in glioma and ovarian cells. Alternative splicing of this PEG3 gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Sep 2009]
PHENOTYPE: Heterozygous mutant females exhibit growth retardation, impaired maternal behavior and diminished milk ejection, and fewer oxytocin neurons. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Gene trapped(3)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T C 19: 31,927,114 V175A probably damaging Het
Adamts5 A T 16: 85,862,764 V880E probably damaging Het
Adgrf1 T A 17: 43,310,260 F463I probably benign Het
Ano1 T A 7: 144,637,086 E249D probably benign Het
Aoc1 A G 6: 48,908,619 D686G probably damaging Het
Cacna1d A T 14: 30,352,978 probably benign Het
Cdc42ep4 A G 11: 113,729,218 S116P probably damaging Het
Ces2a T C 8: 104,740,248 V463A probably damaging Het
Depdc5 A G 5: 32,901,848 D297G probably benign Het
Fsip2 T A 2: 82,990,891 V5656E possibly damaging Het
Gbp5 A G 3: 142,507,729 T469A probably benign Het
Gm21663 C G 5: 25,941,261 probably null Het
Iqch A G 9: 63,524,745 V456A probably benign Het
Lpcat1 A C 13: 73,511,381 I373L probably benign Het
Morc2b C T 17: 33,136,636 V721I probably benign Het
Mrgprb1 C T 7: 48,447,676 V163M probably benign Het
Mtfr2 A G 10: 20,354,226 I142V possibly damaging Het
Muc16 A T 9: 18,658,021 S1067R unknown Het
Myh14 T C 7: 44,630,755 S892G possibly damaging Het
Mylk2 C T 2: 152,911,668 probably null Het
Mzf1 A T 7: 13,043,563 V638E possibly damaging Het
Ncoa1 C T 12: 4,322,934 V156I possibly damaging Het
Nf1 A G 11: 79,556,720 E2450G probably damaging Het
Olfr1048 T C 2: 86,236,658 D52G probably damaging Het
Olfr1086 T A 2: 86,677,226 T36S possibly damaging Het
Olfr114 T A 17: 37,590,143 D70V probably damaging Het
Olfr1245 T C 2: 89,575,703 T8A probably damaging Het
Olfr1313 G A 2: 112,072,196 P129L probably damaging Het
Olfr389 A G 11: 73,777,192 I45T probably damaging Het
Olfr794 T C 10: 129,571,504 L283S probably damaging Het
Olfr969 A G 9: 39,796,124 I250V probably benign Het
P4htm T G 9: 108,596,963 K125N probably damaging Het
Patj A G 4: 98,413,197 T240A probably benign Het
Pcolce2 T C 9: 95,681,621 V220A probably benign Het
Pcyox1 A T 6: 86,394,496 I136N probably damaging Het
Pde4b A G 4: 102,602,806 S395G probably benign Het
Plekhm1 A G 11: 103,370,988 V922A possibly damaging Het
Rad51c T C 11: 87,402,676 N118S possibly damaging Het
Rb1cc1 T A 1: 6,250,005 V1216D possibly damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rlf T C 4: 121,148,787 M999V probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,918 probably benign Het
Samd7 G C 3: 30,751,123 K18N probably benign Het
Sema5b A C 16: 35,651,312 D425A probably benign Het
Siglecg A G 7: 43,411,742 E413G probably benign Het
Tcaf1 A T 6: 42,679,177 N288K probably damaging Het
Tdp1 A G 12: 99,894,732 D210G probably benign Het
Umps A T 16: 33,961,733 L273* probably null Het
Vcan A T 13: 89,705,686 V385D probably damaging Het
Wdr59 T C 8: 111,465,845 T676A probably benign Het
Zdbf2 A G 1: 63,307,559 H1699R probably benign Het
Zfp27 AATCCGCTTGTGCA AA 7: 29,895,021 probably benign Het
Other mutations in Peg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Peg3 APN 7 6710274 missense probably benign 0.09
IGL01410:Peg3 APN 7 6707625 missense probably benign 0.04
IGL01415:Peg3 APN 7 6711653 missense probably damaging 0.99
IGL02073:Peg3 APN 7 6711002 missense probably damaging 1.00
IGL02193:Peg3 APN 7 6711928 missense probably damaging 1.00
IGL02212:Peg3 APN 7 6711416 missense probably benign 0.41
IGL02215:Peg3 APN 7 6709011 missense probably benign 0.00
IGL02407:Peg3 APN 7 6707636 missense probably damaging 0.99
IGL02586:Peg3 APN 7 6710069 missense probably benign
IGL02673:Peg3 APN 7 6710414 missense probably damaging 1.00
IGL02935:Peg3 APN 7 6711129 missense probably damaging 1.00
IGL03277:Peg3 APN 7 6711674 missense probably damaging 1.00
IGL03330:Peg3 APN 7 6710413 missense probably damaging 1.00
IGL03393:Peg3 APN 7 6707649 missense probably damaging 0.99
R0049:Peg3 UTSW 7 6711673 missense possibly damaging 0.85
R0049:Peg3 UTSW 7 6711673 missense possibly damaging 0.85
R0518:Peg3 UTSW 7 6711428 missense probably damaging 1.00
R0521:Peg3 UTSW 7 6711428 missense probably damaging 1.00
R1477:Peg3 UTSW 7 6716142 missense probably damaging 1.00
R1716:Peg3 UTSW 7 6707781 missense possibly damaging 0.93
R1721:Peg3 UTSW 7 6709901 missense possibly damaging 0.92
R1732:Peg3 UTSW 7 6709085 missense possibly damaging 0.72
R2051:Peg3 UTSW 7 6712721 missense probably damaging 0.96
R2288:Peg3 UTSW 7 6709115 missense probably damaging 0.96
R3606:Peg3 UTSW 7 6708509 missense probably damaging 1.00
R5075:Peg3 UTSW 7 6708420 missense probably damaging 1.00
R5076:Peg3 UTSW 7 6708420 missense probably damaging 1.00
R5084:Peg3 UTSW 7 6707849 missense probably damaging 1.00
R5097:Peg3 UTSW 7 6710027 missense probably damaging 0.99
R5121:Peg3 UTSW 7 6710289 missense probably benign 0.20
R5141:Peg3 UTSW 7 6709382 missense probably benign 0.03
R5292:Peg3 UTSW 7 6708260 missense probably damaging 1.00
R5294:Peg3 UTSW 7 6717849 missense possibly damaging 0.88
R5342:Peg3 UTSW 7 6709970 missense probably damaging 1.00
R5415:Peg3 UTSW 7 6708629 missense probably benign
R5906:Peg3 UTSW 7 6717855 missense probably damaging 0.99
R6056:Peg3 UTSW 7 6709571 missense probably damaging 1.00
R6259:Peg3 UTSW 7 6709811 missense probably damaging 0.99
R6529:Peg3 UTSW 7 6708072 missense probably damaging 1.00
R6631:Peg3 UTSW 7 6709070 missense possibly damaging 0.72
R6855:Peg3 UTSW 7 6708798 missense probably benign 0.13
R6861:Peg3 UTSW 7 6711386 nonsense probably null
R6864:Peg3 UTSW 7 6712762 missense probably damaging 1.00
R6892:Peg3 UTSW 7 6708899 missense possibly damaging 0.58
R7018:Peg3 UTSW 7 6708839 missense possibly damaging 0.72
R7039:Peg3 UTSW 7 6717859 missense probably damaging 0.99
R7117:Peg3 UTSW 7 6709168 unclassified probably benign
R7133:Peg3 UTSW 7 6708945 missense probably damaging 1.00
R7493:Peg3 UTSW 7 6709724 missense probably damaging 1.00
R7539:Peg3 UTSW 7 6708168 missense probably benign 0.00
R7642:Peg3 UTSW 7 6709168 unclassified probably benign
R7646:Peg3 UTSW 7 6709222 missense probably benign
R7658:Peg3 UTSW 7 6709610 missense probably damaging 1.00
R7846:Peg3 UTSW 7 6710651 missense probably damaging 1.00
R7853:Peg3 UTSW 7 6708840 missense possibly damaging 0.72
R7903:Peg3 UTSW 7 6709168 unclassified probably benign
R7913:Peg3 UTSW 7 6709168 unclassified probably benign
R7948:Peg3 UTSW 7 6708782 missense probably damaging 1.00
R8219:Peg3 UTSW 7 6708365 missense probably benign 0.00
R8385:Peg3 UTSW 7 6708083 missense probably damaging 1.00
R8672:Peg3 UTSW 7 6708524 missense possibly damaging 0.62
R9133:Peg3 UTSW 7 6709168 unclassified probably benign
R9209:Peg3 UTSW 7 6708227 missense possibly damaging 0.48
R9457:Peg3 UTSW 7 6707999 missense probably damaging 0.99
R9518:Peg3 UTSW 7 6711281 missense probably benign 0.00
R9519:Peg3 UTSW 7 6711395 missense probably benign 0.00
R9599:Peg3 UTSW 7 6711724 missense probably damaging 0.97
RF039:Peg3 UTSW 7 6709168 unclassified probably benign
YA93:Peg3 UTSW 7 6711647 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTCATCACAGGCCTTTACG -3'
(R):5'- CCCACAGTGAAGAGTCTCATG -3'

Sequencing Primer
(F):5'- GCCTTTACGGAATACAGCTGGTC -3'
(R):5'- TCATGGTGATGAGCCCCATG -3'
Posted On 2019-05-13