Incidental Mutation 'R7066:Zfp27'
ID 548567
Institutional Source Beutler Lab
Gene Symbol Zfp27
Ensembl Gene ENSMUSG00000062040
Gene Name zinc finger protein 27
Synonyms mkr-4, Zfp-27
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.624) question?
Stock # R7066 (G1)
Quality Score 217.468
Status Validated
Chromosome 7
Chromosomal Location 29893333-29906572 bp(-) (GRCm38)
Type of Mutation small deletion (4 aa in frame mutation)
DNA Base Change (assembly) AATCCGCTTGTGCA to AA at 29895021 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053521] [ENSMUST00000159920] [ENSMUST00000161904] [ENSMUST00000162592] [ENSMUST00000172448]
AlphaFold P10077
Predicted Effect probably benign
Transcript: ENSMUST00000053521
SMART Domains Protein: ENSMUSP00000054012
Gene: ENSMUSG00000062040

DomainStartEndE-ValueType
KRAB 1 59 2.94e-12 SMART
internal_repeat_2 108 195 4.1e-6 PROSPERO
ZnF_C2H2 205 227 3.11e-2 SMART
ZnF_C2H2 233 255 8.47e-4 SMART
ZnF_C2H2 261 283 2.09e-3 SMART
ZnF_C2H2 289 311 2.91e-2 SMART
ZnF_C2H2 317 339 4.17e-3 SMART
ZnF_C2H2 345 367 4.79e-3 SMART
ZnF_C2H2 401 423 7.15e-2 SMART
ZnF_C2H2 429 451 3.69e-4 SMART
ZnF_C2H2 457 479 1.08e-1 SMART
ZnF_C2H2 485 507 2.57e-3 SMART
ZnF_C2H2 513 535 1.5e-4 SMART
ZnF_C2H2 541 563 1.38e-3 SMART
ZnF_C2H2 569 591 1.03e-2 SMART
ZnF_C2H2 597 619 3.34e-2 SMART
ZnF_C2H2 625 647 8.34e-3 SMART
ZnF_C2H2 653 675 2.36e-2 SMART
ZnF_C2H2 681 703 6.88e-4 SMART
ZnF_C2H2 709 731 2.27e-4 SMART
ZnF_C2H2 737 759 6.88e-4 SMART
ZnF_C2H2 765 787 1.72e-4 SMART
ZnF_C2H2 793 815 3.83e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159920
SMART Domains Protein: ENSMUSP00000125232
Gene: ENSMUSG00000062040

DomainStartEndE-ValueType
KRAB 1 59 2.94e-12 SMART
internal_repeat_2 108 195 4.1e-6 PROSPERO
ZnF_C2H2 205 227 3.11e-2 SMART
ZnF_C2H2 233 255 8.47e-4 SMART
ZnF_C2H2 261 283 2.09e-3 SMART
ZnF_C2H2 289 311 2.91e-2 SMART
ZnF_C2H2 317 339 4.17e-3 SMART
ZnF_C2H2 345 367 4.79e-3 SMART
ZnF_C2H2 401 423 7.15e-2 SMART
ZnF_C2H2 429 451 3.69e-4 SMART
ZnF_C2H2 457 479 1.08e-1 SMART
ZnF_C2H2 485 507 2.57e-3 SMART
ZnF_C2H2 513 535 1.5e-4 SMART
ZnF_C2H2 541 563 1.38e-3 SMART
ZnF_C2H2 569 591 1.03e-2 SMART
ZnF_C2H2 597 619 3.34e-2 SMART
ZnF_C2H2 625 647 8.34e-3 SMART
ZnF_C2H2 653 675 2.36e-2 SMART
ZnF_C2H2 681 703 6.88e-4 SMART
ZnF_C2H2 709 731 2.27e-4 SMART
ZnF_C2H2 737 759 6.88e-4 SMART
ZnF_C2H2 765 787 1.72e-4 SMART
ZnF_C2H2 793 815 3.83e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161904
SMART Domains Protein: ENSMUSP00000124684
Gene: ENSMUSG00000062040

DomainStartEndE-ValueType
KRAB 1 59 2.94e-12 SMART
internal_repeat_2 108 195 4.1e-6 PROSPERO
ZnF_C2H2 205 227 3.11e-2 SMART
ZnF_C2H2 233 255 8.47e-4 SMART
ZnF_C2H2 261 283 2.09e-3 SMART
ZnF_C2H2 289 311 2.91e-2 SMART
ZnF_C2H2 317 339 4.17e-3 SMART
ZnF_C2H2 345 367 4.79e-3 SMART
ZnF_C2H2 401 423 7.15e-2 SMART
ZnF_C2H2 429 451 3.69e-4 SMART
ZnF_C2H2 457 479 1.08e-1 SMART
ZnF_C2H2 485 507 2.57e-3 SMART
ZnF_C2H2 513 535 1.5e-4 SMART
ZnF_C2H2 541 563 1.38e-3 SMART
ZnF_C2H2 569 591 1.03e-2 SMART
ZnF_C2H2 597 619 3.34e-2 SMART
ZnF_C2H2 625 647 8.34e-3 SMART
ZnF_C2H2 653 675 2.36e-2 SMART
ZnF_C2H2 681 703 6.88e-4 SMART
ZnF_C2H2 709 731 2.27e-4 SMART
ZnF_C2H2 737 759 6.88e-4 SMART
ZnF_C2H2 765 787 1.72e-4 SMART
ZnF_C2H2 793 815 3.83e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162592
SMART Domains Protein: ENSMUSP00000123953
Gene: ENSMUSG00000062040

DomainStartEndE-ValueType
KRAB 1 59 2.94e-12 SMART
internal_repeat_2 108 195 4.1e-6 PROSPERO
ZnF_C2H2 205 227 3.11e-2 SMART
ZnF_C2H2 233 255 8.47e-4 SMART
ZnF_C2H2 261 283 2.09e-3 SMART
ZnF_C2H2 289 311 2.91e-2 SMART
ZnF_C2H2 317 339 4.17e-3 SMART
ZnF_C2H2 345 367 4.79e-3 SMART
ZnF_C2H2 401 423 7.15e-2 SMART
ZnF_C2H2 429 451 3.69e-4 SMART
ZnF_C2H2 457 479 1.08e-1 SMART
ZnF_C2H2 485 507 2.57e-3 SMART
ZnF_C2H2 513 535 1.5e-4 SMART
ZnF_C2H2 541 563 1.38e-3 SMART
ZnF_C2H2 569 591 1.03e-2 SMART
ZnF_C2H2 597 619 3.34e-2 SMART
ZnF_C2H2 625 647 8.34e-3 SMART
ZnF_C2H2 653 675 2.36e-2 SMART
ZnF_C2H2 681 703 6.88e-4 SMART
ZnF_C2H2 709 731 2.27e-4 SMART
ZnF_C2H2 737 759 6.88e-4 SMART
ZnF_C2H2 765 787 1.72e-4 SMART
ZnF_C2H2 793 815 3.83e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172448
SMART Domains Protein: ENSMUSP00000127677
Gene: ENSMUSG00000062040

DomainStartEndE-ValueType
KRAB 1 59 2.94e-12 SMART
internal_repeat_2 108 195 4.1e-6 PROSPERO
ZnF_C2H2 205 227 3.11e-2 SMART
ZnF_C2H2 233 255 8.47e-4 SMART
ZnF_C2H2 261 283 2.09e-3 SMART
ZnF_C2H2 289 311 2.91e-2 SMART
ZnF_C2H2 317 339 4.17e-3 SMART
ZnF_C2H2 345 367 4.79e-3 SMART
ZnF_C2H2 401 423 7.15e-2 SMART
ZnF_C2H2 429 451 3.69e-4 SMART
ZnF_C2H2 457 479 1.08e-1 SMART
ZnF_C2H2 485 507 2.57e-3 SMART
ZnF_C2H2 513 535 1.5e-4 SMART
ZnF_C2H2 541 563 1.38e-3 SMART
ZnF_C2H2 569 591 1.03e-2 SMART
ZnF_C2H2 597 619 3.34e-2 SMART
ZnF_C2H2 625 647 8.34e-3 SMART
ZnF_C2H2 653 675 2.36e-2 SMART
ZnF_C2H2 681 703 6.88e-4 SMART
ZnF_C2H2 709 731 2.27e-4 SMART
ZnF_C2H2 737 759 6.88e-4 SMART
ZnF_C2H2 765 787 1.72e-4 SMART
ZnF_C2H2 793 815 3.83e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T C 19: 31,927,114 V175A probably damaging Het
Adamts5 A T 16: 85,862,764 V880E probably damaging Het
Adgrf1 T A 17: 43,310,260 F463I probably benign Het
Ano1 T A 7: 144,637,086 E249D probably benign Het
Aoc1 A G 6: 48,908,619 D686G probably damaging Het
Cacna1d A T 14: 30,352,978 probably benign Het
Cdc42ep4 A G 11: 113,729,218 S116P probably damaging Het
Ces2a T C 8: 104,740,248 V463A probably damaging Het
Depdc5 A G 5: 32,901,848 D297G probably benign Het
Fsip2 T A 2: 82,990,891 V5656E possibly damaging Het
Gbp5 A G 3: 142,507,729 T469A probably benign Het
Gm21663 C G 5: 25,941,261 probably null Het
Iqch A G 9: 63,524,745 V456A probably benign Het
Lpcat1 A C 13: 73,511,381 I373L probably benign Het
Morc2b C T 17: 33,136,636 V721I probably benign Het
Mrgprb1 C T 7: 48,447,676 V163M probably benign Het
Mtfr2 A G 10: 20,354,226 I142V possibly damaging Het
Muc16 A T 9: 18,658,021 S1067R unknown Het
Myh14 T C 7: 44,630,755 S892G possibly damaging Het
Mylk2 C T 2: 152,911,668 probably null Het
Mzf1 A T 7: 13,043,563 V638E possibly damaging Het
Ncoa1 C T 12: 4,322,934 V156I possibly damaging Het
Nf1 A G 11: 79,556,720 E2450G probably damaging Het
Olfr1048 T C 2: 86,236,658 D52G probably damaging Het
Olfr1086 T A 2: 86,677,226 T36S possibly damaging Het
Olfr114 T A 17: 37,590,143 D70V probably damaging Het
Olfr1245 T C 2: 89,575,703 T8A probably damaging Het
Olfr1313 G A 2: 112,072,196 P129L probably damaging Het
Olfr389 A G 11: 73,777,192 I45T probably damaging Het
Olfr794 T C 10: 129,571,504 L283S probably damaging Het
Olfr969 A G 9: 39,796,124 I250V probably benign Het
P4htm T G 9: 108,596,963 K125N probably damaging Het
Patj A G 4: 98,413,197 T240A probably benign Het
Pcolce2 T C 9: 95,681,621 V220A probably benign Het
Pcyox1 A T 6: 86,394,496 I136N probably damaging Het
Pde4b A G 4: 102,602,806 S395G probably benign Het
Peg3 C A 7: 6,708,857 R1122L probably damaging Het
Plekhm1 A G 11: 103,370,988 V922A possibly damaging Het
Rad51c T C 11: 87,402,676 N118S possibly damaging Het
Rb1cc1 T A 1: 6,250,005 V1216D possibly damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rlf T C 4: 121,148,787 M999V probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,918 probably benign Het
Samd7 G C 3: 30,751,123 K18N probably benign Het
Sema5b A C 16: 35,651,312 D425A probably benign Het
Siglecg A G 7: 43,411,742 E413G probably benign Het
Tcaf1 A T 6: 42,679,177 N288K probably damaging Het
Tdp1 A G 12: 99,894,732 D210G probably benign Het
Umps A T 16: 33,961,733 L273* probably null Het
Vcan A T 13: 89,705,686 V385D probably damaging Het
Wdr59 T C 8: 111,465,845 T676A probably benign Het
Zdbf2 A G 1: 63,307,559 H1699R probably benign Het
Other mutations in Zfp27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Zfp27 APN 7 29894958 missense probably damaging 0.97
IGL02490:Zfp27 APN 7 29894935 missense possibly damaging 0.73
IGL02899:Zfp27 APN 7 29896255 missense possibly damaging 0.91
R0179:Zfp27 UTSW 7 29896425 missense possibly damaging 0.51
R0234:Zfp27 UTSW 7 29894107 missense possibly damaging 0.73
R0234:Zfp27 UTSW 7 29894107 missense possibly damaging 0.73
R0511:Zfp27 UTSW 7 29894522 missense probably damaging 0.97
R1185:Zfp27 UTSW 7 29895829 missense possibly damaging 0.92
R1185:Zfp27 UTSW 7 29895829 missense possibly damaging 0.92
R1185:Zfp27 UTSW 7 29895829 missense possibly damaging 0.92
R1294:Zfp27 UTSW 7 29896312 missense possibly damaging 0.53
R1581:Zfp27 UTSW 7 29896124 missense possibly damaging 0.53
R1763:Zfp27 UTSW 7 29895376 missense possibly damaging 0.96
R2083:Zfp27 UTSW 7 29894783 missense probably benign 0.06
R2217:Zfp27 UTSW 7 29896111 missense possibly damaging 0.96
R2696:Zfp27 UTSW 7 29896367 missense possibly damaging 0.85
R4084:Zfp27 UTSW 7 29895367 missense possibly damaging 0.91
R4864:Zfp27 UTSW 7 29894836 missense probably damaging 0.99
R6057:Zfp27 UTSW 7 29895019 missense possibly damaging 0.83
R6063:Zfp27 UTSW 7 29894302 missense probably damaging 0.97
R6553:Zfp27 UTSW 7 29896393 missense possibly damaging 0.86
R6585:Zfp27 UTSW 7 29896393 missense possibly damaging 0.86
R6800:Zfp27 UTSW 7 29894435 missense probably benign 0.19
R7051:Zfp27 UTSW 7 29895021 small deletion probably benign
R7052:Zfp27 UTSW 7 29895021 small deletion probably benign
R7106:Zfp27 UTSW 7 29895021 small deletion probably benign
R7432:Zfp27 UTSW 7 29895359 missense probably benign 0.33
R7473:Zfp27 UTSW 7 29895899 missense possibly damaging 0.71
R7670:Zfp27 UTSW 7 29894796 missense possibly damaging 0.94
R7739:Zfp27 UTSW 7 29894274 missense possibly damaging 0.93
R7817:Zfp27 UTSW 7 29896390 missense possibly damaging 0.96
R8750:Zfp27 UTSW 7 29895379 missense possibly damaging 0.53
R8819:Zfp27 UTSW 7 29894588 missense probably benign 0.15
R8820:Zfp27 UTSW 7 29894588 missense probably benign 0.15
R9189:Zfp27 UTSW 7 29895934 missense possibly damaging 0.76
R9511:Zfp27 UTSW 7 29894216 missense possibly damaging 0.71
R9705:Zfp27 UTSW 7 29895917 missense possibly damaging 0.93
Z1177:Zfp27 UTSW 7 29895161 missense probably benign 0.33
Z1177:Zfp27 UTSW 7 29896232 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TTTCTGGGTAAAGGCTTTCCC -3'
(R):5'- ATCTCTCGACCGTGCGAAAC -3'

Sequencing Primer
(F):5'- GTGCTACACCCATATGGCTTC -3'
(R):5'- CAGGTCGGAGCTAATCATTCATCAG -3'
Posted On 2019-05-13