Incidental Mutation 'R7066:Siglecg'
ID548568
Institutional Source Beutler Lab
Gene Symbol Siglecg
Ensembl Gene ENSMUSG00000030468
Gene Namesialic acid binding Ig-like lectin G
SynonymsmSiglec-G, A630096C01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R7066 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location43408204-43418358 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43411742 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 413 (E413G)
Ref Sequence ENSEMBL: ENSMUSP00000005592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005592]
Predicted Effect probably benign
Transcript: ENSMUST00000005592
AA Change: E413G

PolyPhen 2 Score 0.403 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000005592
Gene: ENSMUSG00000030468
AA Change: E413G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 27 139 5.21e-2 SMART
IG_like 148 232 8.97e0 SMART
IGc2 262 325 3.38e-10 SMART
IGc2 366 427 8.26e-5 SMART
low complexity region 473 480 N/A INTRINSIC
transmembrane domain 545 564 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SIGLECs are members of the immunoglobulin superfamily that are expressed on the cell surface. Most SIGLECs have 1 or more cytoplasmic immune receptor tyrosine-based inhibitory motifs, or ITIMs. SIGLECs are typically expressed on cells of the innate immune system, with the exception of the B-cell expressed SIGLEC6 (MIM 604405).[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for a null allele exhibit increased B-1 cell numbers, increased IgM levels and IgM-producing plasma cells, and produce more IgM autoantibodies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T C 19: 31,927,114 V175A probably damaging Het
Adamts5 A T 16: 85,862,764 V880E probably damaging Het
Adgrf1 T A 17: 43,310,260 F463I probably benign Het
Ano1 T A 7: 144,637,086 E249D probably benign Het
Aoc1 A G 6: 48,908,619 D686G probably damaging Het
Cacna1d A T 14: 30,352,978 probably benign Het
Cdc42ep4 A G 11: 113,729,218 S116P probably damaging Het
Ces2a T C 8: 104,740,248 V463A probably damaging Het
Depdc5 A G 5: 32,901,848 D297G probably benign Het
Fsip2 T A 2: 82,990,891 V5656E possibly damaging Het
Gbp5 A G 3: 142,507,729 T469A probably benign Het
Gm21663 C G 5: 25,941,261 probably null Het
Iqch A G 9: 63,524,745 V456A probably benign Het
Lpcat1 A C 13: 73,511,381 I373L probably benign Het
Morc2b C T 17: 33,136,636 V721I probably benign Het
Mrgprb1 C T 7: 48,447,676 V163M probably benign Het
Mtfr2 A G 10: 20,354,226 I142V possibly damaging Het
Muc16 A T 9: 18,658,021 S1067R unknown Het
Myh14 T C 7: 44,630,755 S892G possibly damaging Het
Mylk2 C T 2: 152,911,668 probably null Het
Mzf1 A T 7: 13,043,563 V638E possibly damaging Het
Ncoa1 C T 12: 4,322,934 V156I possibly damaging Het
Nf1 A G 11: 79,556,720 E2450G probably damaging Het
Olfr1048 T C 2: 86,236,658 D52G probably damaging Het
Olfr1086 T A 2: 86,677,226 T36S possibly damaging Het
Olfr114 T A 17: 37,590,143 D70V probably damaging Het
Olfr1245 T C 2: 89,575,703 T8A probably damaging Het
Olfr1313 G A 2: 112,072,196 P129L probably damaging Het
Olfr389 A G 11: 73,777,192 I45T probably damaging Het
Olfr794 T C 10: 129,571,504 L283S probably damaging Het
Olfr969 A G 9: 39,796,124 I250V probably benign Het
P4htm T G 9: 108,596,963 K125N probably damaging Het
Patj A G 4: 98,413,197 T240A probably benign Het
Pcolce2 T C 9: 95,681,621 V220A probably benign Het
Pcyox1 A T 6: 86,394,496 I136N probably damaging Het
Pde4b A G 4: 102,602,806 S395G probably benign Het
Peg3 C A 7: 6,708,857 R1122L probably damaging Het
Plekhm1 A G 11: 103,370,988 V922A possibly damaging Het
Rad51c T C 11: 87,402,676 N118S possibly damaging Het
Rb1cc1 T A 1: 6,250,005 V1216D possibly damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rlf T C 4: 121,148,787 M999V probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,918 probably benign Het
Samd7 G C 3: 30,751,123 K18N probably benign Het
Sema5b A C 16: 35,651,312 D425A probably benign Het
Tcaf1 A T 6: 42,679,177 N288K probably damaging Het
Tdp1 A G 12: 99,894,732 D210G probably benign Het
Umps A T 16: 33,961,733 L273* probably null Het
Vcan A T 13: 89,705,686 V385D probably damaging Het
Wdr59 T C 8: 111,465,845 T676A probably benign Het
Zdbf2 A G 1: 63,307,559 H1699R probably benign Het
Zfp27 AATCCGCTTGTGCA AA 7: 29,895,021 probably benign Het
Other mutations in Siglecg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00528:Siglecg APN 7 43409057 missense possibly damaging 0.64
IGL00556:Siglecg APN 7 43411795 missense probably benign 0.02
IGL01806:Siglecg APN 7 43411464 splice site probably null
IGL01947:Siglecg APN 7 43408763 missense probably benign 0.43
IGL02257:Siglecg APN 7 43411904 missense probably benign 0.00
IGL02410:Siglecg APN 7 43408829 missense probably damaging 0.99
IGL02454:Siglecg APN 7 43408895 missense probably benign 0.00
Chamonix UTSW 7 43409422 missense possibly damaging 0.91
Montblanc UTSW 7 43411386 intron probably benign
Shenandoah UTSW 7 43408802 missense probably damaging 0.99
shenandoah2 UTSW 7 43412017 missense possibly damaging 0.82
Sherando UTSW 7 43409057 missense possibly damaging 0.64
Smokies UTSW 7 43409279 missense probably benign 0.02
IGL02988:Siglecg UTSW 7 43418052 missense probably damaging 1.00
R0134:Siglecg UTSW 7 43411171 missense probably damaging 1.00
R0225:Siglecg UTSW 7 43411171 missense probably damaging 1.00
R0480:Siglecg UTSW 7 43411126 missense probably benign 0.42
R1538:Siglecg UTSW 7 43417889 missense possibly damaging 0.53
R1681:Siglecg UTSW 7 43408941 missense probably benign 0.17
R2358:Siglecg UTSW 7 43409422 missense possibly damaging 0.91
R4428:Siglecg UTSW 7 43417926 missense possibly damaging 0.84
R4429:Siglecg UTSW 7 43417926 missense possibly damaging 0.84
R4736:Siglecg UTSW 7 43417908 missense probably benign 0.03
R4754:Siglecg UTSW 7 43411871 intron probably benign
R5017:Siglecg UTSW 7 43411386 intron probably benign
R5713:Siglecg UTSW 7 43408802 missense probably damaging 0.99
R5777:Siglecg UTSW 7 43409413 missense possibly damaging 0.80
R5892:Siglecg UTSW 7 43412204 intron probably benign
R6153:Siglecg UTSW 7 43412017 missense possibly damaging 0.82
R6154:Siglecg UTSW 7 43412017 missense possibly damaging 0.82
R6331:Siglecg UTSW 7 43408754 missense possibly damaging 0.83
R6562:Siglecg UTSW 7 43409057 missense possibly damaging 0.64
R6749:Siglecg UTSW 7 43408979 missense probably benign 0.00
R7884:Siglecg UTSW 7 43409279 missense probably benign 0.02
R8275:Siglecg UTSW 7 43412468 missense probably benign
RF006:Siglecg UTSW 7 43408864 nonsense probably null
Z1177:Siglecg UTSW 7 43412022 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCTCAGGAATGCCATCTCCC -3'
(R):5'- ACTGTGAAGGAGGCATTGCTG -3'

Sequencing Primer
(F):5'- GGAATGCCATCTCCCTCCCAG -3'
(R):5'- AGTTGCAGTGCAGACCCTTG -3'
Posted On2019-05-13