Incidental Mutation 'R7066:Mrgprb1'
ID 548570
Institutional Source Beutler Lab
Gene Symbol Mrgprb1
Ensembl Gene ENSMUSG00000070547
Gene Name MAS-related GPR, member B1
Synonyms MrgB1
MMRRC Submission 045162-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.048) question?
Stock # R7066 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 48093861-48106090 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 48097424 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 163 (V163M)
Ref Sequence ENSEMBL: ENSMUSP00000091946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094384] [ENSMUST00000188095] [ENSMUST00000188918]
AlphaFold Q3UG61
Predicted Effect probably benign
Transcript: ENSMUST00000094384
AA Change: V163M

PolyPhen 2 Score 0.273 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000091946
Gene: ENSMUSG00000070547
AA Change: V163M

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 50 227 5.5e-11 PFAM
Pfam:7tm_1 59 290 4.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188095
Predicted Effect probably benign
Transcript: ENSMUST00000188918
SMART Domains Protein: ENSMUSP00000140432
Gene: ENSMUSG00000070547

DomainStartEndE-ValueType
SCOP:d1l9ha_ 23 84 3e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T C 19: 31,904,514 (GRCm39) V175A probably damaging Het
Adamts5 A T 16: 85,659,652 (GRCm39) V880E probably damaging Het
Adgrf1 T A 17: 43,621,151 (GRCm39) F463I probably benign Het
Ano1 T A 7: 144,190,823 (GRCm39) E249D probably benign Het
Aoc1 A G 6: 48,885,553 (GRCm39) D686G probably damaging Het
Cacna1d A T 14: 30,074,935 (GRCm39) probably benign Het
Cdc42ep4 A G 11: 113,620,044 (GRCm39) S116P probably damaging Het
Ces2a T C 8: 105,466,880 (GRCm39) V463A probably damaging Het
Depdc5 A G 5: 33,059,192 (GRCm39) D297G probably benign Het
Fsip2 T A 2: 82,821,235 (GRCm39) V5656E possibly damaging Het
Gbp5 A G 3: 142,213,490 (GRCm39) T469A probably benign Het
Gm21663 C G 5: 26,146,259 (GRCm39) probably null Het
Iqch A G 9: 63,432,027 (GRCm39) V456A probably benign Het
Lpcat1 A C 13: 73,659,500 (GRCm39) I373L probably benign Het
Morc2b C T 17: 33,355,610 (GRCm39) V721I probably benign Het
Mtfr2 A G 10: 20,229,972 (GRCm39) I142V possibly damaging Het
Muc16 A T 9: 18,569,317 (GRCm39) S1067R unknown Het
Myh14 T C 7: 44,280,179 (GRCm39) S892G possibly damaging Het
Mylk2 C T 2: 152,753,588 (GRCm39) probably null Het
Mzf1 A T 7: 12,777,490 (GRCm39) V638E possibly damaging Het
Ncoa1 C T 12: 4,372,934 (GRCm39) V156I possibly damaging Het
Nf1 A G 11: 79,447,546 (GRCm39) E2450G probably damaging Het
Or14j3 T A 17: 37,901,034 (GRCm39) D70V probably damaging Het
Or1e29 A G 11: 73,668,018 (GRCm39) I45T probably damaging Het
Or4a72 T C 2: 89,406,047 (GRCm39) T8A probably damaging Het
Or4f60 G A 2: 111,902,541 (GRCm39) P129L probably damaging Het
Or5t7 T A 2: 86,507,570 (GRCm39) T36S possibly damaging Het
Or6c88 T C 10: 129,407,373 (GRCm39) L283S probably damaging Het
Or8g54 A G 9: 39,707,420 (GRCm39) I250V probably benign Het
Or8k17 T C 2: 86,067,002 (GRCm39) D52G probably damaging Het
P4htm T G 9: 108,474,162 (GRCm39) K125N probably damaging Het
Patj A G 4: 98,301,434 (GRCm39) T240A probably benign Het
Pcolce2 T C 9: 95,563,674 (GRCm39) V220A probably benign Het
Pcyox1 A T 6: 86,371,478 (GRCm39) I136N probably damaging Het
Pde4b A G 4: 102,460,003 (GRCm39) S395G probably benign Het
Peg3 C A 7: 6,711,856 (GRCm39) R1122L probably damaging Het
Plekhm1 A G 11: 103,261,814 (GRCm39) V922A possibly damaging Het
Rad51c T C 11: 87,293,502 (GRCm39) N118S possibly damaging Het
Rb1cc1 T A 1: 6,320,229 (GRCm39) V1216D possibly damaging Het
Rictor C T 15: 6,801,635 (GRCm39) S441L probably benign Het
Rlf T C 4: 121,005,984 (GRCm39) M999V probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,229,125 (GRCm39) probably benign Het
Samd7 G C 3: 30,805,272 (GRCm39) K18N probably benign Het
Sema5b A C 16: 35,471,682 (GRCm39) D425A probably benign Het
Siglecg A G 7: 43,061,166 (GRCm39) E413G probably benign Het
Tcaf1 A T 6: 42,656,111 (GRCm39) N288K probably damaging Het
Tdp1 A G 12: 99,860,991 (GRCm39) D210G probably benign Het
Umps A T 16: 33,782,103 (GRCm39) L273* probably null Het
Vcan A T 13: 89,853,805 (GRCm39) V385D probably damaging Het
Wdr59 T C 8: 112,192,477 (GRCm39) T676A probably benign Het
Zdbf2 A G 1: 63,346,718 (GRCm39) H1699R probably benign Het
Zfp27 AATCCGCTTGTGCA AA 7: 29,594,446 (GRCm39) probably benign Het
Other mutations in Mrgprb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Mrgprb1 APN 7 48,097,291 (GRCm39) missense probably damaging 0.99
IGL01141:Mrgprb1 APN 7 48,097,775 (GRCm39) missense probably benign 0.36
IGL01393:Mrgprb1 APN 7 48,097,754 (GRCm39) missense possibly damaging 0.48
IGL02430:Mrgprb1 APN 7 48,097,409 (GRCm39) missense possibly damaging 0.95
IGL02485:Mrgprb1 APN 7 48,097,465 (GRCm39) missense possibly damaging 0.88
R0026:Mrgprb1 UTSW 7 48,096,952 (GRCm39) missense possibly damaging 0.66
R0051:Mrgprb1 UTSW 7 48,096,962 (GRCm39) missense probably benign 0.01
R0789:Mrgprb1 UTSW 7 48,105,932 (GRCm39) splice site probably benign
R1223:Mrgprb1 UTSW 7 48,097,435 (GRCm39) missense possibly damaging 0.61
R1327:Mrgprb1 UTSW 7 48,097,177 (GRCm39) missense possibly damaging 0.87
R1456:Mrgprb1 UTSW 7 48,097,777 (GRCm39) missense probably damaging 0.98
R1561:Mrgprb1 UTSW 7 48,096,873 (GRCm39) splice site probably null
R1567:Mrgprb1 UTSW 7 48,097,201 (GRCm39) missense probably damaging 0.97
R2030:Mrgprb1 UTSW 7 48,097,076 (GRCm39) missense possibly damaging 0.83
R2165:Mrgprb1 UTSW 7 48,097,070 (GRCm39) missense probably benign 0.00
R2885:Mrgprb1 UTSW 7 48,097,469 (GRCm39) missense probably damaging 1.00
R3108:Mrgprb1 UTSW 7 48,097,076 (GRCm39) missense possibly damaging 0.93
R3919:Mrgprb1 UTSW 7 48,097,829 (GRCm39) missense probably benign 0.03
R4021:Mrgprb1 UTSW 7 48,096,871 (GRCm39) missense possibly damaging 0.95
R4613:Mrgprb1 UTSW 7 48,097,456 (GRCm39) missense possibly damaging 0.91
R4809:Mrgprb1 UTSW 7 48,097,739 (GRCm39) missense possibly damaging 0.89
R5249:Mrgprb1 UTSW 7 48,097,225 (GRCm39) missense possibly damaging 0.91
R5425:Mrgprb1 UTSW 7 48,097,719 (GRCm39) missense possibly damaging 0.81
R5555:Mrgprb1 UTSW 7 48,097,523 (GRCm39) missense probably benign 0.06
R5595:Mrgprb1 UTSW 7 48,097,432 (GRCm39) missense probably damaging 0.99
R5982:Mrgprb1 UTSW 7 48,097,568 (GRCm39) missense probably benign 0.01
R6746:Mrgprb1 UTSW 7 48,097,645 (GRCm39) missense possibly damaging 0.82
R7141:Mrgprb1 UTSW 7 48,097,435 (GRCm39) missense possibly damaging 0.61
R7633:Mrgprb1 UTSW 7 48,097,331 (GRCm39) missense probably benign 0.01
R8072:Mrgprb1 UTSW 7 48,097,895 (GRCm39) nonsense probably null
R8080:Mrgprb1 UTSW 7 48,096,658 (GRCm39) splice site probably null
R8112:Mrgprb1 UTSW 7 48,097,682 (GRCm39) missense probably damaging 0.97
R8493:Mrgprb1 UTSW 7 48,097,321 (GRCm39) missense probably damaging 0.99
R8817:Mrgprb1 UTSW 7 48,097,070 (GRCm39) missense probably benign 0.01
R9135:Mrgprb1 UTSW 7 48,097,046 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TAAGCACCAAGGCCAGACTG -3'
(R):5'- AGCAGGAATGCCTTCTCTGTC -3'

Sequencing Primer
(F):5'- GCCAGACTGGATCCCAAGAG -3'
(R):5'- AGGAATGCCTTCTCTGTCTACATC -3'
Posted On 2019-05-13