Incidental Mutation 'R7066:Ano1'
ID548572
Institutional Source Beutler Lab
Gene Symbol Ano1
Ensembl Gene ENSMUSG00000031075
Gene Nameanoctamin 1, calcium activated chloride channel
SynonymsTmem16a
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7066 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location144588549-144751974 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 144637086 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 249 (E249D)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033393] [ENSMUST00000118556] [ENSMUST00000121758]
Predicted Effect probably benign
Transcript: ENSMUST00000033393
AA Change: E362D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000033393
Gene: ENSMUSG00000031075
AA Change: E362D

DomainStartEndE-ValueType
low complexity region 129 147 N/A INTRINSIC
Pfam:Anoctamin 320 898 1.3e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118556
AA Change: E420D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113899
Gene: ENSMUSG00000031075
AA Change: E420D

DomainStartEndE-ValueType
Pfam:Anoct_dimer 112 375 5.5e-83 PFAM
Pfam:Anoctamin 378 955 6.7e-140 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121758
AA Change: E419D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112616
Gene: ENSMUSG00000031075
AA Change: E419D

DomainStartEndE-ValueType
Pfam:Anoct_dimer 54 317 7.1e-83 PFAM
Pfam:Anoctamin 320 901 2.2e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152531
AA Change: E249D

PolyPhen 2 Score 0.348 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000119653
Gene: ENSMUSG00000031075
AA Change: E249D

DomainStartEndE-ValueType
Pfam:Anoct_dimer 2 205 4.4e-64 PFAM
Pfam:Anoctamin 208 335 3e-36 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (52/53)
MGI Phenotype PHENOTYPE: Mice homozygous for a knockout allele exhibit postnatal death associated with aerophagia, slow postnatal weight gain, cyanosis, and abnormal tracheal morphology. Mice homozygous for a different knock-out allele exhibit proteinuria and intracellular endosomal vesicles in PTE cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T C 19: 31,927,114 V175A probably damaging Het
Adamts5 A T 16: 85,862,764 V880E probably damaging Het
Adgrf1 T A 17: 43,310,260 F463I probably benign Het
Aoc1 A G 6: 48,908,619 D686G probably damaging Het
Cacna1d A T 14: 30,352,978 probably benign Het
Cdc42ep4 A G 11: 113,729,218 S116P probably damaging Het
Ces2a T C 8: 104,740,248 V463A probably damaging Het
Depdc5 A G 5: 32,901,848 D297G probably benign Het
Fsip2 T A 2: 82,990,891 V5656E possibly damaging Het
Gbp5 A G 3: 142,507,729 T469A probably benign Het
Gm21663 C G 5: 25,941,261 probably null Het
Iqch A G 9: 63,524,745 V456A probably benign Het
Lpcat1 A C 13: 73,511,381 I373L probably benign Het
Morc2b C T 17: 33,136,636 V721I probably benign Het
Mrgprb1 C T 7: 48,447,676 V163M probably benign Het
Mtfr2 A G 10: 20,354,226 I142V possibly damaging Het
Muc16 A T 9: 18,658,021 S1067R unknown Het
Myh14 T C 7: 44,630,755 S892G possibly damaging Het
Mylk2 C T 2: 152,911,668 probably null Het
Mzf1 A T 7: 13,043,563 V638E possibly damaging Het
Ncoa1 C T 12: 4,322,934 V156I possibly damaging Het
Nf1 A G 11: 79,556,720 E2450G probably damaging Het
Olfr1048 T C 2: 86,236,658 D52G probably damaging Het
Olfr1086 T A 2: 86,677,226 T36S possibly damaging Het
Olfr114 T A 17: 37,590,143 D70V probably damaging Het
Olfr1245 T C 2: 89,575,703 T8A probably damaging Het
Olfr1313 G A 2: 112,072,196 P129L probably damaging Het
Olfr389 A G 11: 73,777,192 I45T probably damaging Het
Olfr794 T C 10: 129,571,504 L283S probably damaging Het
Olfr969 A G 9: 39,796,124 I250V probably benign Het
P4htm T G 9: 108,596,963 K125N probably damaging Het
Patj A G 4: 98,413,197 T240A probably benign Het
Pcolce2 T C 9: 95,681,621 V220A probably benign Het
Pcyox1 A T 6: 86,394,496 I136N probably damaging Het
Pde4b A G 4: 102,602,806 S395G probably benign Het
Peg3 C A 7: 6,708,857 R1122L probably damaging Het
Plekhm1 A G 11: 103,370,988 V922A possibly damaging Het
Rad51c T C 11: 87,402,676 N118S possibly damaging Het
Rb1cc1 T A 1: 6,250,005 V1216D possibly damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rlf T C 4: 121,148,787 M999V probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,918 probably benign Het
Samd7 G C 3: 30,751,123 K18N probably benign Het
Sema5b A C 16: 35,651,312 D425A probably benign Het
Siglecg A G 7: 43,411,742 E413G probably benign Het
Tcaf1 A T 6: 42,679,177 N288K probably damaging Het
Tdp1 A G 12: 99,894,732 D210G probably benign Het
Umps A T 16: 33,961,733 L273* probably null Het
Vcan A T 13: 89,705,686 V385D probably damaging Het
Wdr59 T C 8: 111,465,845 T676A probably benign Het
Zdbf2 A G 1: 63,307,559 H1699R probably benign Het
Zfp27 AATCCGCTTGTGCA AA 7: 29,895,021 probably benign Het
Other mutations in Ano1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Ano1 APN 7 144638513 missense probably damaging 1.00
IGL00754:Ano1 APN 7 144597231 missense probably damaging 0.98
IGL00780:Ano1 APN 7 144655630 missense probably damaging 0.99
IGL00918:Ano1 APN 7 144644752 splice site probably benign
IGL01112:Ano1 APN 7 144637145 missense possibly damaging 0.52
IGL01285:Ano1 APN 7 144644742 missense probably benign 0.00
IGL01285:Ano1 APN 7 144595538 missense probably damaging 0.98
IGL01308:Ano1 APN 7 144595498 missense probably damaging 0.99
IGL01407:Ano1 APN 7 144637111 missense probably benign 0.22
IGL01672:Ano1 APN 7 144655675 missense probably damaging 0.96
IGL01920:Ano1 APN 7 144611454 splice site probably benign
IGL01926:Ano1 APN 7 144610875 missense possibly damaging 0.94
IGL02164:Ano1 APN 7 144637181 missense possibly damaging 0.91
IGL02190:Ano1 APN 7 144618883 missense probably benign 0.41
IGL02214:Ano1 APN 7 144655708 missense possibly damaging 0.80
IGL02299:Ano1 APN 7 144590075 missense possibly damaging 0.80
IGL02567:Ano1 APN 7 144611625 missense probably damaging 1.00
IGL03131:Ano1 APN 7 144603585 missense possibly damaging 0.90
IGL03291:Ano1 APN 7 144621675 missense probably damaging 1.00
IGL03299:Ano1 APN 7 144654256 missense probably damaging 1.00
IGL03394:Ano1 APN 7 144595439 splice site probably null
PIT4434001:Ano1 UTSW 7 144610895 missense probably benign 0.28
R0502:Ano1 UTSW 7 144597215 missense probably damaging 1.00
R0595:Ano1 UTSW 7 144590153 missense possibly damaging 0.94
R0732:Ano1 UTSW 7 144619488 critical splice acceptor site probably null
R0970:Ano1 UTSW 7 144595571 missense probably benign 0.02
R0988:Ano1 UTSW 7 144633653 missense possibly damaging 0.94
R1074:Ano1 UTSW 7 144611680 missense probably damaging 0.98
R1301:Ano1 UTSW 7 144633689 missense possibly damaging 0.60
R1528:Ano1 UTSW 7 144595566 missense probably damaging 1.00
R2018:Ano1 UTSW 7 144654250 missense probably damaging 1.00
R2056:Ano1 UTSW 7 144648052 missense probably damaging 1.00
R2057:Ano1 UTSW 7 144648052 missense probably damaging 1.00
R2058:Ano1 UTSW 7 144648052 missense probably damaging 1.00
R2059:Ano1 UTSW 7 144611390 missense probably damaging 1.00
R2860:Ano1 UTSW 7 144590012 missense probably damaging 1.00
R2861:Ano1 UTSW 7 144590012 missense probably damaging 1.00
R3770:Ano1 UTSW 7 144595569 missense probably damaging 1.00
R3970:Ano1 UTSW 7 144607963 missense probably benign 0.00
R4179:Ano1 UTSW 7 144650505 missense probably damaging 1.00
R4489:Ano1 UTSW 7 144611742 missense probably benign 0.00
R4678:Ano1 UTSW 7 144669552 missense probably benign 0.01
R4915:Ano1 UTSW 7 144611375 missense possibly damaging 0.69
R5114:Ano1 UTSW 7 144657083 missense possibly damaging 0.71
R5362:Ano1 UTSW 7 144648600 unclassified probably benign
R5364:Ano1 UTSW 7 144637204 missense probably damaging 1.00
R5366:Ano1 UTSW 7 144654209 missense possibly damaging 0.85
R5387:Ano1 UTSW 7 144648619 missense probably benign
R5762:Ano1 UTSW 7 144648037 missense probably damaging 0.99
R5857:Ano1 UTSW 7 144637103 missense probably benign 0.02
R6091:Ano1 UTSW 7 144669434 missense probably benign 0.12
R6093:Ano1 UTSW 7 144611377 missense possibly damaging 0.72
R6177:Ano1 UTSW 7 144678741 missense possibly damaging 0.79
R6246:Ano1 UTSW 7 144633725 missense possibly damaging 0.82
R6274:Ano1 UTSW 7 144618863 missense probably benign 0.01
R6323:Ano1 UTSW 7 144611686 missense possibly damaging 0.95
R6574:Ano1 UTSW 7 144607916 critical splice donor site probably null
R6782:Ano1 UTSW 7 144621687 missense probably damaging 1.00
R6880:Ano1 UTSW 7 144644742 missense probably benign 0.00
R6909:Ano1 UTSW 7 144655731 missense probably damaging 0.96
R7073:Ano1 UTSW 7 144638552 missense probably damaging 0.96
R7146:Ano1 UTSW 7 144655656 missense probably benign 0.00
R7420:Ano1 UTSW 7 144655641 missense probably benign 0.00
R7874:Ano1 UTSW 7 144621724 missense probably damaging 1.00
R8468:Ano1 UTSW 7 144655620 missense probably damaging 1.00
R8867:Ano1 UTSW 7 144669660 missense possibly damaging 0.66
R8923:Ano1 UTSW 7 144650551 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- TGACGAGATCCCACCTCTTC -3'
(R):5'- AGAGCCTCACACTCTGACTCTC -3'

Sequencing Primer
(F):5'- AGCTGACAGAAACCAAGTTCTC -3'
(R):5'- CTCTGACTCTCGGGAAAAACAGTG -3'
Posted On2019-05-13