Incidental Mutation 'R7066:P4htm'
ID548579
Institutional Source Beutler Lab
Gene Symbol P4htm
Ensembl Gene ENSMUSG00000006675
Gene Nameprolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)
SynonymsP4h-tm, 4933406E20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R7066 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location108578862-108597667 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 108596963 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 125 (K125N)
Ref Sequence ENSEMBL: ENSMUSP00000141843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006853] [ENSMUST00000193621]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006853
AA Change: K125N

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000006853
Gene: ENSMUSG00000006675
AA Change: K125N

DomainStartEndE-ValueType
transmembrane domain 61 83 N/A INTRINSIC
P4Hc 143 460 1.26e-19 SMART
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000193621
AA Change: K125N

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141843
Gene: ENSMUSG00000006675
AA Change: K125N

DomainStartEndE-ValueType
transmembrane domain 61 83 N/A INTRINSIC
Blast:P4Hc 143 211 5e-39 BLAST
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of prolyl 4-hydroxylases. This protein is a prolyl hydroxylase that may be involved in the degradation of hypoxia-inducible transcription factors under normoxia. It plays a role in adaptation to hypoxia and may be related to cellular oxygen sensing. Alternatively spliced variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit decreased body weight, normal erythropoiesis, and cardioprotection after ischemia-reperfusion injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T C 19: 31,927,114 V175A probably damaging Het
Adamts5 A T 16: 85,862,764 V880E probably damaging Het
Adgrf1 T A 17: 43,310,260 F463I probably benign Het
Ano1 T A 7: 144,637,086 E249D probably benign Het
Aoc1 A G 6: 48,908,619 D686G probably damaging Het
Cacna1d A T 14: 30,352,978 probably benign Het
Cdc42ep4 A G 11: 113,729,218 S116P probably damaging Het
Ces2a T C 8: 104,740,248 V463A probably damaging Het
Depdc5 A G 5: 32,901,848 D297G probably benign Het
Fsip2 T A 2: 82,990,891 V5656E possibly damaging Het
Gbp5 A G 3: 142,507,729 T469A probably benign Het
Gm21663 C G 5: 25,941,261 probably null Het
Iqch A G 9: 63,524,745 V456A probably benign Het
Lpcat1 A C 13: 73,511,381 I373L probably benign Het
Morc2b C T 17: 33,136,636 V721I probably benign Het
Mrgprb1 C T 7: 48,447,676 V163M probably benign Het
Mtfr2 A G 10: 20,354,226 I142V possibly damaging Het
Muc16 A T 9: 18,658,021 S1067R unknown Het
Myh14 T C 7: 44,630,755 S892G possibly damaging Het
Mylk2 C T 2: 152,911,668 probably null Het
Mzf1 A T 7: 13,043,563 V638E possibly damaging Het
Ncoa1 C T 12: 4,322,934 V156I possibly damaging Het
Nf1 A G 11: 79,556,720 E2450G probably damaging Het
Olfr1048 T C 2: 86,236,658 D52G probably damaging Het
Olfr1086 T A 2: 86,677,226 T36S possibly damaging Het
Olfr114 T A 17: 37,590,143 D70V probably damaging Het
Olfr1245 T C 2: 89,575,703 T8A probably damaging Het
Olfr1313 G A 2: 112,072,196 P129L probably damaging Het
Olfr389 A G 11: 73,777,192 I45T probably damaging Het
Olfr794 T C 10: 129,571,504 L283S probably damaging Het
Olfr969 A G 9: 39,796,124 I250V probably benign Het
Patj A G 4: 98,413,197 T240A probably benign Het
Pcolce2 T C 9: 95,681,621 V220A probably benign Het
Pcyox1 A T 6: 86,394,496 I136N probably damaging Het
Pde4b A G 4: 102,602,806 S395G probably benign Het
Peg3 C A 7: 6,708,857 R1122L probably damaging Het
Plekhm1 A G 11: 103,370,988 V922A possibly damaging Het
Rad51c T C 11: 87,402,676 N118S possibly damaging Het
Rb1cc1 T A 1: 6,250,005 V1216D possibly damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rlf T C 4: 121,148,787 M999V probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,918 probably benign Het
Samd7 G C 3: 30,751,123 K18N probably benign Het
Sema5b A C 16: 35,651,312 D425A probably benign Het
Siglecg A G 7: 43,411,742 E413G probably benign Het
Tcaf1 A T 6: 42,679,177 N288K probably damaging Het
Tdp1 A G 12: 99,894,732 D210G probably benign Het
Umps A T 16: 33,961,733 L273* probably null Het
Vcan A T 13: 89,705,686 V385D probably damaging Het
Wdr59 T C 8: 111,465,845 T676A probably benign Het
Zdbf2 A G 1: 63,307,559 H1699R probably benign Het
Zfp27 AATCCGCTTGTGCA AA 7: 29,895,021 probably benign Het
Other mutations in P4htm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:P4htm APN 9 108583736 missense probably damaging 1.00
IGL02205:P4htm APN 9 108581962 missense probably benign 0.08
IGL02756:P4htm APN 9 108579778 missense probably damaging 1.00
IGL02802:P4htm UTSW 9 108582856 missense probably benign 0.00
R0605:P4htm UTSW 9 108583724 missense probably null 0.17
R3922:P4htm UTSW 9 108582895 missense probably benign
R4562:P4htm UTSW 9 108581996 missense probably null 1.00
R4730:P4htm UTSW 9 108579772 missense possibly damaging 0.89
R4900:P4htm UTSW 9 108579228 missense probably damaging 1.00
R5027:P4htm UTSW 9 108579293 missense probably benign 0.16
R5124:P4htm UTSW 9 108581942 missense possibly damaging 0.59
R5633:P4htm UTSW 9 108579723 missense probably damaging 1.00
R5877:P4htm UTSW 9 108583733 missense possibly damaging 0.94
R5927:P4htm UTSW 9 108597383 missense probably damaging 1.00
R6163:P4htm UTSW 9 108581951 missense probably damaging 0.99
R6798:P4htm UTSW 9 108582918 missense possibly damaging 0.83
R6920:P4htm UTSW 9 108583613 missense probably benign 0.01
R6962:P4htm UTSW 9 108579195 missense possibly damaging 0.49
R7183:P4htm UTSW 9 108581860 missense possibly damaging 0.95
R7376:P4htm UTSW 9 108580792 missense probably damaging 0.98
R7506:P4htm UTSW 9 108583679 missense probably damaging 1.00
R7533:P4htm UTSW 9 108596937 missense probably benign 0.02
R7874:P4htm UTSW 9 108596949 missense probably benign 0.01
R7957:P4htm UTSW 9 108596949 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTACGAAGCAGCCATGTTC -3'
(R):5'- GGCATCAAGGTAAGAACATCCC -3'

Sequencing Primer
(F):5'- TACGAAGCAGCCATGTTCAAAATAG -3'
(R):5'- AAGGAACCGTGGCTCAGCTC -3'
Posted On2019-05-13