Incidental Mutation 'R0613:Sdhc'
ID54858
Institutional Source Beutler Lab
Gene Symbol Sdhc
Ensembl Gene ENSMUSG00000058076
Gene Namesuccinate dehydrogenase complex, subunit C, integral membrane protein
Synonyms
MMRRC Submission 038802-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0613 (G1)
Quality Score182
Status Validated
Chromosome1
Chromosomal Location171127165-171150603 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 171129844 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 156 (V156E)
Ref Sequence ENSEMBL: ENSMUSP00000106968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027959] [ENSMUST00000081560] [ENSMUST00000111336] [ENSMUST00000124157] [ENSMUST00000127394] [ENSMUST00000129651] [ENSMUST00000143623] [ENSMUST00000151340]
Predicted Effect probably benign
Transcript: ENSMUST00000027959
SMART Domains Protein: ENSMUSP00000027959
Gene: ENSMUSG00000026649

DomainStartEndE-ValueType
low complexity region 122 136 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081560
AA Change: V122E

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000080273
Gene: ENSMUSG00000058076
AA Change: V122E

DomainStartEndE-ValueType
Pfam:Sdh_cyt 12 132 2.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111336
AA Change: V156E

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000106968
Gene: ENSMUSG00000058076
AA Change: V156E

DomainStartEndE-ValueType
Pfam:Sdh_cyt 46 166 2.4e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124157
SMART Domains Protein: ENSMUSP00000115108
Gene: ENSMUSG00000026649

DomainStartEndE-ValueType
low complexity region 150 164 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127394
Predicted Effect probably benign
Transcript: ENSMUST00000129651
SMART Domains Protein: ENSMUSP00000114967
Gene: ENSMUSG00000026649

DomainStartEndE-ValueType
low complexity region 166 180 N/A INTRINSIC
low complexity region 217 228 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143623
Predicted Effect probably benign
Transcript: ENSMUST00000151340
SMART Domains Protein: ENSMUSP00000123188
Gene: ENSMUSG00000026649

DomainStartEndE-ValueType
low complexity region 122 136 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156789
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.3%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of four nuclear-encoded subunits that comprise succinate dehydrogenase, also known as mitochondrial complex II, a key enzyme complex of the tricarboxylic acid cycle and aerobic respiratory chains of mitochondria. The encoded protein is one of two integral membrane proteins that anchor other subunits of the complex, which form the catalytic core, to the inner mitochondrial membrane. There are several related pseudogenes for this gene on different chromosomes. Mutations in this gene have been associated with paragangliomas. Alternatively spliced transcript variants have been described. [provided by RefSeq, May 2013]
PHENOTYPE: Heterozygous compound knockouts (with Sdhb or Sdhb and Sdhd) show reduced increase in blood hemoglobin under hypoxic conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acd A T 8: 105,700,568 probably null Het
Adcy9 A G 16: 4,419,539 S3P probably damaging Het
Adgrl4 T C 3: 151,543,222 probably benign Het
Aff3 T C 1: 38,209,923 E700G probably benign Het
Ahctf1 A G 1: 179,769,414 S56P probably damaging Het
Atp12a T A 14: 56,374,521 I384N probably damaging Het
Brca1 A T 11: 101,508,210 S1519T probably benign Het
Ccl25 T C 8: 4,349,850 V94A probably benign Het
Cep170 T C 1: 176,774,680 T287A probably benign Het
Ces1a A G 8: 93,025,581 S383P probably benign Het
Cntnap3 A T 13: 64,758,414 F793I probably damaging Het
Ctsm T C 13: 61,539,682 R89G probably damaging Het
Cyp2j12 T G 4: 96,102,079 T417P probably damaging Het
D430041D05Rik G C 2: 104,167,950 P1836R probably damaging Het
Edn2 T A 4: 120,161,864 probably null Het
Emc1 T A 4: 139,375,072 probably benign Het
Fam189a2 T A 19: 23,986,489 N239Y probably damaging Het
Fras1 T C 5: 96,700,488 probably benign Het
Fsip2 A T 2: 82,993,795 D6624V probably damaging Het
Gpr107 A G 2: 31,178,285 Y253C probably damaging Het
Gpr108 A G 17: 57,238,174 probably benign Het
Grik1 A G 16: 88,051,333 probably null Het
Gtf3c1 G A 7: 125,644,134 P1766L possibly damaging Het
Gucy2c A T 6: 136,760,723 N293K probably damaging Het
Hps6 C A 19: 46,003,821 P66T probably benign Het
Hspa9 A T 18: 34,947,980 V216E probably damaging Het
Igsf8 T A 1: 172,317,589 M224K probably benign Het
Igsf9b T C 9: 27,326,920 V569A probably damaging Het
Itgb4 A T 11: 115,993,342 I952F probably damaging Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Khdrbs2 A G 1: 32,657,522 H344R possibly damaging Het
Kmo C A 1: 175,637,892 R71S probably damaging Het
Lrrc31 A G 3: 30,685,035 probably benign Het
Map1b T A 13: 99,441,641 D168V probably damaging Het
Mfsd6 T C 1: 52,658,696 probably benign Het
Mgst1 G A 6: 138,156,245 G186D probably damaging Het
Mrc1 C T 2: 14,294,819 A740V probably damaging Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Mtor T C 4: 148,526,046 Y1605H possibly damaging Het
Ncoa4 T A 14: 32,176,552 L443Q probably damaging Het
Nelfa G A 5: 33,903,463 probably benign Het
Nepn T A 10: 52,401,257 L363Q probably damaging Het
Nfat5 A G 8: 107,366,295 T630A possibly damaging Het
Nipal4 A T 11: 46,150,384 V328E probably benign Het
Olfr1228 A T 2: 89,249,125 C178S probably damaging Het
Olfr1391 T A 11: 49,327,748 S112R possibly damaging Het
Olfr462 A T 11: 87,889,227 V223E possibly damaging Het
Olfr747 T A 14: 50,681,404 I77F probably benign Het
Olfr809 T A 10: 129,776,262 M116K probably damaging Het
Olfr924 T A 9: 38,848,613 C166* probably null Het
Otogl A T 10: 107,817,070 N1140K probably damaging Het
Ppip5k2 A C 1: 97,752,740 Y236* probably null Het
Prelid1 C T 13: 55,324,343 R111* probably null Het
Prpf8 T C 11: 75,503,444 L1771P probably damaging Het
Ptprb A T 10: 116,302,325 Y378F possibly damaging Het
Ptprb A G 10: 116,302,378 T396A possibly damaging Het
Rab3il1 T C 19: 10,028,364 L174P probably damaging Het
Rab4a T C 8: 123,823,835 V18A possibly damaging Het
Scn3a T A 2: 65,472,284 M1273L possibly damaging Het
Slco3a1 T C 7: 74,346,634 probably benign Het
Syne3 T C 12: 104,958,112 T343A probably benign Het
Syt11 A G 3: 88,762,469 C39R probably damaging Het
Tll2 G T 19: 41,104,990 D462E probably damaging Het
Tmem132e T A 11: 82,438,338 V481D probably damaging Het
Tmem161b C T 13: 84,251,320 L17F probably damaging Het
Vmn2r105 T A 17: 20,208,316 I833F probably damaging Het
Vstm2a A T 11: 16,263,140 N175I probably damaging Het
Xpnpep1 G T 19: 53,006,353 D238E probably damaging Het
Zfp112 G A 7: 24,127,028 G807D probably benign Het
Zfp518b A T 5: 38,673,603 V353E probably damaging Het
Zfp69 T C 4: 120,934,347 E39G probably benign Het
Zfp865 A G 7: 5,029,091 H25R possibly damaging Het
Other mutations in Sdhc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02531:Sdhc APN 1 171136018 missense probably damaging 1.00
IGL02931:Sdhc APN 1 171143555 splice site probably benign
R0665:Sdhc UTSW 1 171136057 missense probably damaging 1.00
R0714:Sdhc UTSW 1 171129919 unclassified probably benign
R1480:Sdhc UTSW 1 171145801 missense probably benign 0.01
R4807:Sdhc UTSW 1 171136057 missense probably damaging 1.00
R6174:Sdhc UTSW 1 171138702 nonsense probably null
R6533:Sdhc UTSW 1 171129827 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TAAGCCGCTCTACTGCACTCCAAG -3'
(R):5'- AGGGATATGCTGCTTTTCTCGGAAC -3'

Sequencing Primer
(F):5'- TACTGCACTCCAAGGGGATTG -3'
(R):5'- TTTTCTCGGAACCCCAAAAAGG -3'
Posted On2013-07-11