Incidental Mutation 'R0613:Igsf8'
ID54859
Institutional Source Beutler Lab
Gene Symbol Igsf8
Ensembl Gene ENSMUSG00000038034
Gene Nameimmunoglobulin superfamily, member 8
SynonymsPGRL, KCT-4, ESTM34, EWI-2, PG regulatory-like protein
MMRRC Submission 038802-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0613 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location172261641-172319841 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 172317589 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 224 (M224K)
Ref Sequence ENSEMBL: ENSMUSP00000083076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039506] [ENSMUST00000062387] [ENSMUST00000085912] [ENSMUST00000128508] [ENSMUST00000139528] [ENSMUST00000194204] [ENSMUST00000195659]
Predicted Effect probably benign
Transcript: ENSMUST00000039506
AA Change: M224K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000041232
Gene: ENSMUSG00000038034
AA Change: M224K

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 32 147 1.38e-6 SMART
low complexity region 155 166 N/A INTRINSIC
IG 169 285 2.3e-3 SMART
IG 309 433 9.49e-5 SMART
IG 445 571 3.59e-5 SMART
transmembrane domain 578 600 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000062387
SMART Domains Protein: ENSMUSP00000060110
Gene: ENSMUSG00000038026

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
Pfam:IRK 25 350 3.1e-142 PFAM
low complexity region 362 377 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085912
AA Change: M224K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000083076
Gene: ENSMUSG00000038034
AA Change: M224K

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
IG 32 147 1.38e-6 SMART
low complexity region 155 166 N/A INTRINSIC
IG 169 285 2.3e-3 SMART
IG 309 433 9.49e-5 SMART
IG 445 571 3.59e-5 SMART
transmembrane domain 578 600 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128508
SMART Domains Protein: ENSMUSP00000122611
Gene: ENSMUSG00000038034

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
IG 32 147 1.38e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139528
AA Change: M161K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000134280
Gene: ENSMUSG00000038034
AA Change: M161K

DomainStartEndE-ValueType
IG_like 19 84 3.66e1 SMART
low complexity region 92 103 N/A INTRINSIC
IG 106 222 2.3e-3 SMART
IG 246 370 9.49e-5 SMART
IG 382 508 3.59e-5 SMART
transmembrane domain 515 537 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150598
Predicted Effect probably benign
Transcript: ENSMUST00000194204
SMART Domains Protein: ENSMUSP00000141633
Gene: ENSMUSG00000038026

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
Pfam:IRK 25 361 7.4e-165 PFAM
low complexity region 362 377 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194505
Predicted Effect probably benign
Transcript: ENSMUST00000195659
SMART Domains Protein: ENSMUSP00000141313
Gene: ENSMUSG00000038034

DomainStartEndE-ValueType
Blast:IG 1 67 2e-42 BLAST
SCOP:d1nkr_1 6 64 1e-3 SMART
transmembrane domain 74 96 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.3%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member the EWI subfamily of the immunoglobulin protein superfamily. Members of this family contain a single transmembrane domain, an EWI (Glu-Trp-Ile)-motif and a variable number of immunoglobulin domains. This protein interacts with the tetraspanins CD81 and CD9 and may regulate their role in certain cellular functions including cell migration and viral infection. The encoded protein may also function as a tumor suppressor by inhibiting the proliferation of certain cancers. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acd A T 8: 105,700,568 probably null Het
Adcy9 A G 16: 4,419,539 S3P probably damaging Het
Adgrl4 T C 3: 151,543,222 probably benign Het
Aff3 T C 1: 38,209,923 E700G probably benign Het
Ahctf1 A G 1: 179,769,414 S56P probably damaging Het
Atp12a T A 14: 56,374,521 I384N probably damaging Het
Brca1 A T 11: 101,508,210 S1519T probably benign Het
Ccl25 T C 8: 4,349,850 V94A probably benign Het
Cep170 T C 1: 176,774,680 T287A probably benign Het
Ces1a A G 8: 93,025,581 S383P probably benign Het
Cntnap3 A T 13: 64,758,414 F793I probably damaging Het
Ctsm T C 13: 61,539,682 R89G probably damaging Het
Cyp2j12 T G 4: 96,102,079 T417P probably damaging Het
D430041D05Rik G C 2: 104,167,950 P1836R probably damaging Het
Edn2 T A 4: 120,161,864 probably null Het
Emc1 T A 4: 139,375,072 probably benign Het
Fam189a2 T A 19: 23,986,489 N239Y probably damaging Het
Fras1 T C 5: 96,700,488 probably benign Het
Fsip2 A T 2: 82,993,795 D6624V probably damaging Het
Gpr107 A G 2: 31,178,285 Y253C probably damaging Het
Gpr108 A G 17: 57,238,174 probably benign Het
Grik1 A G 16: 88,051,333 probably null Het
Gtf3c1 G A 7: 125,644,134 P1766L possibly damaging Het
Gucy2c A T 6: 136,760,723 N293K probably damaging Het
Hps6 C A 19: 46,003,821 P66T probably benign Het
Hspa9 A T 18: 34,947,980 V216E probably damaging Het
Igsf9b T C 9: 27,326,920 V569A probably damaging Het
Itgb4 A T 11: 115,993,342 I952F probably damaging Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Khdrbs2 A G 1: 32,657,522 H344R possibly damaging Het
Kmo C A 1: 175,637,892 R71S probably damaging Het
Lrrc31 A G 3: 30,685,035 probably benign Het
Map1b T A 13: 99,441,641 D168V probably damaging Het
Mfsd6 T C 1: 52,658,696 probably benign Het
Mgst1 G A 6: 138,156,245 G186D probably damaging Het
Mrc1 C T 2: 14,294,819 A740V probably damaging Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Mtor T C 4: 148,526,046 Y1605H possibly damaging Het
Ncoa4 T A 14: 32,176,552 L443Q probably damaging Het
Nelfa G A 5: 33,903,463 probably benign Het
Nepn T A 10: 52,401,257 L363Q probably damaging Het
Nfat5 A G 8: 107,366,295 T630A possibly damaging Het
Nipal4 A T 11: 46,150,384 V328E probably benign Het
Olfr1228 A T 2: 89,249,125 C178S probably damaging Het
Olfr1391 T A 11: 49,327,748 S112R possibly damaging Het
Olfr462 A T 11: 87,889,227 V223E possibly damaging Het
Olfr747 T A 14: 50,681,404 I77F probably benign Het
Olfr809 T A 10: 129,776,262 M116K probably damaging Het
Olfr924 T A 9: 38,848,613 C166* probably null Het
Otogl A T 10: 107,817,070 N1140K probably damaging Het
Ppip5k2 A C 1: 97,752,740 Y236* probably null Het
Prelid1 C T 13: 55,324,343 R111* probably null Het
Prpf8 T C 11: 75,503,444 L1771P probably damaging Het
Ptprb A T 10: 116,302,325 Y378F possibly damaging Het
Ptprb A G 10: 116,302,378 T396A possibly damaging Het
Rab3il1 T C 19: 10,028,364 L174P probably damaging Het
Rab4a T C 8: 123,823,835 V18A possibly damaging Het
Scn3a T A 2: 65,472,284 M1273L possibly damaging Het
Sdhc A T 1: 171,129,844 V156E probably benign Het
Slco3a1 T C 7: 74,346,634 probably benign Het
Syne3 T C 12: 104,958,112 T343A probably benign Het
Syt11 A G 3: 88,762,469 C39R probably damaging Het
Tll2 G T 19: 41,104,990 D462E probably damaging Het
Tmem132e T A 11: 82,438,338 V481D probably damaging Het
Tmem161b C T 13: 84,251,320 L17F probably damaging Het
Vmn2r105 T A 17: 20,208,316 I833F probably damaging Het
Vstm2a A T 11: 16,263,140 N175I probably damaging Het
Xpnpep1 G T 19: 53,006,353 D238E probably damaging Het
Zfp112 G A 7: 24,127,028 G807D probably benign Het
Zfp518b A T 5: 38,673,603 V353E probably damaging Het
Zfp69 T C 4: 120,934,347 E39G probably benign Het
Zfp865 A G 7: 5,029,091 H25R possibly damaging Het
Other mutations in Igsf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Igsf8 APN 1 172317544 missense possibly damaging 0.48
IGL02090:Igsf8 APN 1 172312589 intron probably benign
IGL02523:Igsf8 APN 1 172319413 utr 3 prime probably benign
IGL03092:Igsf8 APN 1 172312529 intron probably benign
IGL03184:Igsf8 APN 1 172318632 missense probably damaging 0.96
R0398:Igsf8 UTSW 1 172317499 missense probably damaging 1.00
R0468:Igsf8 UTSW 1 172318796 missense probably damaging 1.00
R0494:Igsf8 UTSW 1 172318698 missense probably benign 0.06
R0612:Igsf8 UTSW 1 172319407 makesense probably null
R0883:Igsf8 UTSW 1 172316259 missense possibly damaging 0.67
R0941:Igsf8 UTSW 1 172316396 missense probably damaging 1.00
R1689:Igsf8 UTSW 1 172318937 missense probably damaging 0.99
R1706:Igsf8 UTSW 1 172317405 missense probably damaging 1.00
R2050:Igsf8 UTSW 1 172318865 missense probably damaging 1.00
R2182:Igsf8 UTSW 1 172290728 critical splice donor site probably null
R3625:Igsf8 UTSW 1 172317769 missense probably benign 0.18
R3833:Igsf8 UTSW 1 172318270 missense probably benign 0.00
R4674:Igsf8 UTSW 1 172318912 nonsense probably null
R4796:Igsf8 UTSW 1 172316322 missense probably benign 0.07
R6768:Igsf8 UTSW 1 172317532 missense probably damaging 1.00
R7519:Igsf8 UTSW 1 172316307 missense probably benign 0.38
Z1176:Igsf8 UTSW 1 172318354 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCCAAGCCCTCTCTCACTAAAG -3'
(R):5'- AGAGTCTGCACATCAACATGAGCC -3'

Sequencing Primer
(F):5'- AGTTCTTCCAGATGAGCTGC -3'
(R):5'- TCAACATGAGCCAGGACTG -3'
Posted On2013-07-11