Incidental Mutation 'R7066:Sema5b'
ID548594
Institutional Source Beutler Lab
Gene Symbol Sema5b
Ensembl Gene ENSMUSG00000052133
Gene Namesema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B
SynonymsSemG, Semag, SemG
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7066 (G1)
Quality Score220.009
Status Validated
Chromosome16
Chromosomal Location35541145-35664732 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 35651312 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 425 (D425A)
Ref Sequence ENSEMBL: ENSMUSP00000057494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050625] [ENSMUST00000120756]
Predicted Effect probably benign
Transcript: ENSMUST00000050625
AA Change: D425A

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000057494
Gene: ENSMUSG00000052133
AA Change: D425A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Sema 68 479 1.68e-174 SMART
PSI 497 544 9.18e-12 SMART
TSP1 609 662 3.34e-15 SMART
TSP1 667 713 3.42e-12 SMART
TSP1 798 850 1.58e-16 SMART
TSP1 855 907 2.45e-13 SMART
TSP1 910 957 1.02e-1 SMART
transmembrane domain 977 999 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120756
AA Change: D425A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000112536
Gene: ENSMUSG00000052133
AA Change: D425A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Sema 68 479 1.68e-174 SMART
PSI 497 544 9.18e-12 SMART
TSP1 609 662 3.34e-15 SMART
TSP1 667 742 7.61e-10 SMART
TSP1 827 879 1.58e-16 SMART
TSP1 884 936 2.45e-13 SMART
TSP1 939 986 1.02e-1 SMART
transmembrane domain 1006 1028 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semaphorin protein family which regulates axon growth during development of the nervous system. The encoded protein has a characteristic Sema domain near the N-terminus, through which semaphorins bind to plexin, and five thrombospondin type 1 repeats in the C-terminal region of the protein. The protein product may be cleaved and exist as a secreted molecule (PMID: 19463192). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null mutation display defects in neurite arborization of multiple retinal cell types. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T C 19: 31,927,114 V175A probably damaging Het
Adamts5 A T 16: 85,862,764 V880E probably damaging Het
Adgrf1 T A 17: 43,310,260 F463I probably benign Het
Ano1 T A 7: 144,637,086 E249D probably benign Het
Aoc1 A G 6: 48,908,619 D686G probably damaging Het
Cacna1d A T 14: 30,352,978 probably benign Het
Cdc42ep4 A G 11: 113,729,218 S116P probably damaging Het
Ces2a T C 8: 104,740,248 V463A probably damaging Het
Depdc5 A G 5: 32,901,848 D297G probably benign Het
Fsip2 T A 2: 82,990,891 V5656E possibly damaging Het
Gbp5 A G 3: 142,507,729 T469A probably benign Het
Gm21663 C G 5: 25,941,261 probably null Het
Iqch A G 9: 63,524,745 V456A probably benign Het
Lpcat1 A C 13: 73,511,381 I373L probably benign Het
Morc2b C T 17: 33,136,636 V721I probably benign Het
Mrgprb1 C T 7: 48,447,676 V163M probably benign Het
Mtfr2 A G 10: 20,354,226 I142V possibly damaging Het
Muc16 A T 9: 18,658,021 S1067R unknown Het
Myh14 T C 7: 44,630,755 S892G possibly damaging Het
Mylk2 C T 2: 152,911,668 probably null Het
Mzf1 A T 7: 13,043,563 V638E possibly damaging Het
Ncoa1 C T 12: 4,322,934 V156I possibly damaging Het
Nf1 A G 11: 79,556,720 E2450G probably damaging Het
Olfr1048 T C 2: 86,236,658 D52G probably damaging Het
Olfr1086 T A 2: 86,677,226 T36S possibly damaging Het
Olfr114 T A 17: 37,590,143 D70V probably damaging Het
Olfr1245 T C 2: 89,575,703 T8A probably damaging Het
Olfr1313 G A 2: 112,072,196 P129L probably damaging Het
Olfr389 A G 11: 73,777,192 I45T probably damaging Het
Olfr794 T C 10: 129,571,504 L283S probably damaging Het
Olfr969 A G 9: 39,796,124 I250V probably benign Het
P4htm T G 9: 108,596,963 K125N probably damaging Het
Patj A G 4: 98,413,197 T240A probably benign Het
Pcolce2 T C 9: 95,681,621 V220A probably benign Het
Pcyox1 A T 6: 86,394,496 I136N probably damaging Het
Pde4b A G 4: 102,602,806 S395G probably benign Het
Peg3 C A 7: 6,708,857 R1122L probably damaging Het
Plekhm1 A G 11: 103,370,988 V922A possibly damaging Het
Rad51c T C 11: 87,402,676 N118S possibly damaging Het
Rb1cc1 T A 1: 6,250,005 V1216D possibly damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rlf T C 4: 121,148,787 M999V probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,918 probably benign Het
Samd7 G C 3: 30,751,123 K18N probably benign Het
Siglecg A G 7: 43,411,742 E413G probably benign Het
Tcaf1 A T 6: 42,679,177 N288K probably damaging Het
Tdp1 A G 12: 99,894,732 D210G probably benign Het
Umps A T 16: 33,961,733 L273* probably null Het
Vcan A T 13: 89,705,686 V385D probably damaging Het
Wdr59 T C 8: 111,465,845 T676A probably benign Het
Zdbf2 A G 1: 63,307,559 H1699R probably benign Het
Zfp27 AATCCGCTTGTGCA AA 7: 29,895,021 probably benign Het
Other mutations in Sema5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Sema5b APN 16 35651315 missense probably damaging 1.00
IGL01584:Sema5b APN 16 35645423 missense probably damaging 1.00
IGL01859:Sema5b APN 16 35647109 missense possibly damaging 0.94
IGL02195:Sema5b APN 16 35660479 critical splice acceptor site probably null
IGL02346:Sema5b APN 16 35649755 missense probably damaging 1.00
IGL02850:Sema5b APN 16 35660515 missense probably benign 0.01
IGL03277:Sema5b APN 16 35651312 missense probably damaging 0.96
R0101:Sema5b UTSW 16 35663102 splice site probably benign
R0368:Sema5b UTSW 16 35628100 missense probably damaging 1.00
R0426:Sema5b UTSW 16 35646355 missense probably damaging 1.00
R0675:Sema5b UTSW 16 35660333 missense probably benign 0.00
R0905:Sema5b UTSW 16 35622631 missense probably benign 0.33
R1163:Sema5b UTSW 16 35628096 missense probably benign 0.19
R1195:Sema5b UTSW 16 35651660 missense probably null 0.94
R1195:Sema5b UTSW 16 35651660 missense probably null 0.94
R1666:Sema5b UTSW 16 35658482 missense probably benign 0.03
R1706:Sema5b UTSW 16 35649755 missense probably damaging 0.98
R1733:Sema5b UTSW 16 35646367 missense probably damaging 1.00
R1775:Sema5b UTSW 16 35660324 missense probably benign
R2215:Sema5b UTSW 16 35660215 missense probably damaging 1.00
R2844:Sema5b UTSW 16 35659931 missense probably damaging 0.98
R3086:Sema5b UTSW 16 35622723 missense probably benign
R3613:Sema5b UTSW 16 35660150 missense probably benign
R4774:Sema5b UTSW 16 35663182 missense probably damaging 1.00
R5743:Sema5b UTSW 16 35658476 missense probably damaging 1.00
R5856:Sema5b UTSW 16 35646386 nonsense probably null
R5993:Sema5b UTSW 16 35646202 missense probably damaging 1.00
R6248:Sema5b UTSW 16 35628007 splice site probably null
R6420:Sema5b UTSW 16 35663146 missense probably benign 0.08
R6795:Sema5b UTSW 16 35658571 nonsense probably null
R6825:Sema5b UTSW 16 35628007 splice site probably null
R7244:Sema5b UTSW 16 35660545 missense probably benign
R7446:Sema5b UTSW 16 35647203 missense probably damaging 1.00
R7497:Sema5b UTSW 16 35661330 missense probably damaging 1.00
R7516:Sema5b UTSW 16 35651170 missense probably benign 0.05
R7878:Sema5b UTSW 16 35661626 missense probably benign 0.00
R7922:Sema5b UTSW 16 35658256 frame shift probably null
R8397:Sema5b UTSW 16 35651321 missense possibly damaging 0.59
R8537:Sema5b UTSW 16 35651609 missense possibly damaging 0.49
Z1088:Sema5b UTSW 16 35660590 missense probably damaging 0.99
Z1176:Sema5b UTSW 16 35628018 missense probably benign 0.01
Z1176:Sema5b UTSW 16 35646273 missense probably benign 0.05
Z1176:Sema5b UTSW 16 35649864 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCATGAGAGTTCCCACTGTG -3'
(R):5'- CTTTCAGGATGGTACCCGACTC -3'

Sequencing Primer
(F):5'- GCACCAGTGACTCGGTTTC -3'
(R):5'- AGCCATGGCTTCTTACAG -3'
Posted On2019-05-13