Incidental Mutation 'R7066:Olfr114'
ID548597
Institutional Source Beutler Lab
Gene Symbol Olfr114
Ensembl Gene ENSMUSG00000062629
Gene Nameolfactory receptor 114
SynonymsMOR218-10, GA_x6K02T2PSCP-2049802-2048870
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R7066 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location37589233-37592743 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37590143 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 70 (D70V)
Ref Sequence ENSEMBL: ENSMUSP00000149735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076914] [ENSMUST00000214871] [ENSMUST00000216249]
Predicted Effect probably damaging
Transcript: ENSMUST00000076914
AA Change: D70V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076181
Gene: ENSMUSG00000062629
AA Change: D70V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2e-43 PFAM
Pfam:7TM_GPCR_Srsx 35 305 3.7e-6 PFAM
Pfam:7tm_1 41 290 3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214871
AA Change: D70V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216249
AA Change: D70V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T C 19: 31,927,114 V175A probably damaging Het
Adamts5 A T 16: 85,862,764 V880E probably damaging Het
Adgrf1 T A 17: 43,310,260 F463I probably benign Het
Ano1 T A 7: 144,637,086 E249D probably benign Het
Aoc1 A G 6: 48,908,619 D686G probably damaging Het
Cacna1d A T 14: 30,352,978 probably benign Het
Cdc42ep4 A G 11: 113,729,218 S116P probably damaging Het
Ces2a T C 8: 104,740,248 V463A probably damaging Het
Depdc5 A G 5: 32,901,848 D297G probably benign Het
Fsip2 T A 2: 82,990,891 V5656E possibly damaging Het
Gbp5 A G 3: 142,507,729 T469A probably benign Het
Gm21663 C G 5: 25,941,261 probably null Het
Iqch A G 9: 63,524,745 V456A probably benign Het
Lpcat1 A C 13: 73,511,381 I373L probably benign Het
Morc2b C T 17: 33,136,636 V721I probably benign Het
Mrgprb1 C T 7: 48,447,676 V163M probably benign Het
Mtfr2 A G 10: 20,354,226 I142V possibly damaging Het
Muc16 A T 9: 18,658,021 S1067R unknown Het
Myh14 T C 7: 44,630,755 S892G possibly damaging Het
Mylk2 C T 2: 152,911,668 probably null Het
Mzf1 A T 7: 13,043,563 V638E possibly damaging Het
Ncoa1 C T 12: 4,322,934 V156I possibly damaging Het
Nf1 A G 11: 79,556,720 E2450G probably damaging Het
Olfr1048 T C 2: 86,236,658 D52G probably damaging Het
Olfr1086 T A 2: 86,677,226 T36S possibly damaging Het
Olfr1245 T C 2: 89,575,703 T8A probably damaging Het
Olfr1313 G A 2: 112,072,196 P129L probably damaging Het
Olfr389 A G 11: 73,777,192 I45T probably damaging Het
Olfr794 T C 10: 129,571,504 L283S probably damaging Het
Olfr969 A G 9: 39,796,124 I250V probably benign Het
P4htm T G 9: 108,596,963 K125N probably damaging Het
Patj A G 4: 98,413,197 T240A probably benign Het
Pcolce2 T C 9: 95,681,621 V220A probably benign Het
Pcyox1 A T 6: 86,394,496 I136N probably damaging Het
Pde4b A G 4: 102,602,806 S395G probably benign Het
Peg3 C A 7: 6,708,857 R1122L probably damaging Het
Plekhm1 A G 11: 103,370,988 V922A possibly damaging Het
Rad51c T C 11: 87,402,676 N118S possibly damaging Het
Rb1cc1 T A 1: 6,250,005 V1216D possibly damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rlf T C 4: 121,148,787 M999V probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,918 probably benign Het
Samd7 G C 3: 30,751,123 K18N probably benign Het
Sema5b A C 16: 35,651,312 D425A probably benign Het
Siglecg A G 7: 43,411,742 E413G probably benign Het
Tcaf1 A T 6: 42,679,177 N288K probably damaging Het
Tdp1 A G 12: 99,894,732 D210G probably benign Het
Umps A T 16: 33,961,733 L273* probably null Het
Vcan A T 13: 89,705,686 V385D probably damaging Het
Wdr59 T C 8: 111,465,845 T676A probably benign Het
Zdbf2 A G 1: 63,307,559 H1699R probably benign Het
Zfp27 AATCCGCTTGTGCA AA 7: 29,895,021 probably benign Het
Other mutations in Olfr114
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Olfr114 APN 17 37590072 missense possibly damaging 0.93
IGL01624:Olfr114 APN 17 37589925 missense probably benign 0.00
IGL02026:Olfr114 APN 17 37589407 utr 3 prime probably benign
IGL02608:Olfr114 APN 17 37590219 missense probably damaging 1.00
IGL02632:Olfr114 APN 17 37590341 missense probably benign 0.00
IGL02990:Olfr114 APN 17 37589668 missense probably benign 0.00
R0114:Olfr114 UTSW 17 37589415 makesense probably null
R1156:Olfr114 UTSW 17 37589517 missense possibly damaging 0.93
R1366:Olfr114 UTSW 17 37589764 missense probably benign 0.03
R3413:Olfr114 UTSW 17 37589696 missense probably benign 0.00
R3701:Olfr114 UTSW 17 37589826 nonsense probably null
R6122:Olfr114 UTSW 17 37589926 missense probably benign 0.12
R6639:Olfr114 UTSW 17 37589931 missense probably damaging 1.00
R7316:Olfr114 UTSW 17 37590135 missense probably damaging 0.99
R8340:Olfr114 UTSW 17 37590143 missense probably damaging 1.00
R8483:Olfr114 UTSW 17 37589975 missense possibly damaging 0.52
R8555:Olfr114 UTSW 17 37589649 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CCACCTACACTTTCTGGGACAC -3'
(R):5'- GTGGATTCCTCCTCATGGGATTC -3'

Sequencing Primer
(F):5'- CTGGGACACATGATGATCTCATAGTG -3'
(R):5'- GGATTCTCTGACAACCATGAGCTG -3'
Posted On2019-05-13