Incidental Mutation 'R7067:Dnm3'
ID548603
Institutional Source Beutler Lab
Gene Symbol Dnm3
Ensembl Gene ENSMUSG00000040265
Gene Namedynamin 3
SynonymsB230343F03Rik, 9630020E24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7067 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location161982453-162478034 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 162320971 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 277 (L277P)
Ref Sequence ENSEMBL: ENSMUSP00000083241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070330] [ENSMUST00000086074]
Predicted Effect probably damaging
Transcript: ENSMUST00000070330
AA Change: L277P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064538
Gene: ENSMUSG00000040265
AA Change: L277P

DomainStartEndE-ValueType
DYNc 6 245 1.48e-182 SMART
PH 516 623 1.58e-11 SMART
GED 644 735 6.82e-33 SMART
low complexity region 738 751 N/A INTRINSIC
low complexity region 756 771 N/A INTRINSIC
low complexity region 799 812 N/A INTRINSIC
low complexity region 824 852 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000086074
AA Change: L277P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083241
Gene: ENSMUSG00000040265
AA Change: L277P

DomainStartEndE-ValueType
DYNc 6 245 1.48e-182 SMART
PH 516 623 1.58e-11 SMART
GED 648 739 6.82e-33 SMART
low complexity region 742 755 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 803 816 N/A INTRINSIC
low complexity region 828 856 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of guanosine triphosphate (GTP)-binding proteins that associate with microtubules and are involved in vesicular transport. The encoded protein functions in the development of megakaryocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a targeted allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik T A 16: 91,056,033 S72C probably damaging Het
9330182L06Rik G T 5: 9,266,295 A9S possibly damaging Het
Abca13 A G 11: 9,291,845 D1236G probably benign Het
Abcc6 T C 7: 46,018,690 N165D probably benign Het
Aebp1 A G 11: 5,866,431 probably null Het
Anapc4 A G 5: 52,862,235 T580A probably benign Het
Apob T C 12: 8,009,423 I2602T probably damaging Het
Arap2 A G 5: 62,654,044 probably null Het
Asap3 T A 4: 136,241,362 probably null Het
Bend4 A G 5: 67,400,268 Y402H probably damaging Het
Crtc2 A G 3: 90,260,182 N271S probably benign Het
Csf2rb2 A T 15: 78,292,494 W233R probably damaging Het
Ctgf A G 10: 24,596,975 Y261C probably benign Het
Cyp2u1 G A 3: 131,293,553 L460F probably damaging Het
Efemp1 A T 11: 28,867,926 N135I probably damaging Het
Fsip2 T A 2: 82,980,734 S2466T possibly damaging Het
Gal3st2 C T 1: 93,874,725 A276V possibly damaging Het
Gm47985 A T 1: 151,183,490 D294V unknown Het
Golga1 A T 2: 39,047,719 D104E probably benign Het
Hnrnpr C T 4: 136,327,393 A219V probably damaging Het
Hsd3b7 T C 7: 127,800,716 probably null Het
Hspa8 T C 9: 40,804,625 I562T probably damaging Het
Htra4 C T 8: 25,033,701 V283M probably damaging Het
Il1f5 C T 2: 24,277,529 R11* probably null Het
Iqcd A G 5: 120,605,147 T325A probably damaging Het
Kif23 A T 9: 61,924,989 M624K probably benign Het
Krt25 G T 11: 99,317,383 Q340K probably benign Het
Lamp3 T A 16: 19,699,663 N275Y probably damaging Het
Lpin2 A C 17: 71,244,858 K789T possibly damaging Het
Mroh2b T C 15: 4,900,504 I24T probably benign Het
Muc16 T A 9: 18,658,251 I991F unknown Het
Ntf5 T A 7: 45,415,624 L60Q probably damaging Het
Nuak1 A G 10: 84,440,294 S22P possibly damaging Het
Obox8 T C 7: 14,333,054 T22A possibly damaging Het
Olfr1053 T A 2: 86,314,567 T240S probably damaging Het
Pde8a T C 7: 81,317,326 V405A probably benign Het
Phc2 T C 4: 128,747,141 S147P probably benign Het
Pole G T 5: 110,334,218 G142V probably damaging Het
Poli G A 18: 70,509,417 Q508* probably null Het
Repin1 T A 6: 48,597,916 L537* probably null Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Samd7 G C 3: 30,751,123 K18N probably benign Het
Slc30a2 T A 4: 134,344,218 probably null Het
Slit3 A G 11: 35,508,230 S141G probably benign Het
Spata5 C T 3: 37,431,698 Q190* probably null Het
Spon2 A G 5: 33,214,614 S283P probably damaging Het
Srgap3 A T 6: 112,757,305 probably benign Het
Syde2 A G 3: 145,988,264 D89G probably benign Het
Syne1 A G 10: 5,234,586 I4099T probably damaging Het
Syt5 T C 7: 4,543,076 D105G probably benign Het
Tlx3 C T 11: 33,203,204 G86S probably damaging Het
Trim24 A T 6: 37,957,840 probably null Het
Umodl1 G A 17: 30,982,272 V392I probably damaging Het
Unc80 C A 1: 66,646,572 T2285K possibly damaging Het
Vars G A 17: 35,011,479 V513I probably damaging Het
Vmn1r87 T A 7: 13,131,922 Q146L probably benign Het
Vmn2r62 T C 7: 42,764,878 I714V probably benign Het
Xbp1 T A 11: 5,524,275 S159T probably damaging Het
Xrn1 T A 9: 95,969,512 H194Q probably damaging Het
Zc3h4 A T 7: 16,429,051 K459* probably null Het
Zdhhc6 G A 19: 55,304,439 R292* probably null Het
Zfp383 T A 7: 29,908,646 M1K probably null Het
Zfp703 A G 8: 26,979,016 D236G probably damaging Het
Other mutations in Dnm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Dnm3 APN 1 162011926 missense probably damaging 1.00
IGL02444:Dnm3 APN 1 162010875 missense possibly damaging 0.46
IGL02481:Dnm3 APN 1 162010902 missense probably damaging 0.99
IGL02623:Dnm3 APN 1 162355432 missense probably damaging 0.99
IGL03132:Dnm3 APN 1 162011105 critical splice acceptor site probably null
IGL03330:Dnm3 APN 1 162320991 missense probably benign 0.00
fever UTSW 1 162321127 splice site probably null
nobel UTSW 1 162477705 missense probably damaging 1.00
splotare UTSW 1 162320987 missense probably damaging 0.98
LCD18:Dnm3 UTSW 1 162406561 intron probably benign
R0066:Dnm3 UTSW 1 162407361 missense probably damaging 0.98
R0066:Dnm3 UTSW 1 162407361 missense probably damaging 0.98
R0240:Dnm3 UTSW 1 162353625 missense probably benign 0.00
R0240:Dnm3 UTSW 1 162353625 missense probably benign 0.00
R0968:Dnm3 UTSW 1 162019819 splice site probably benign
R1161:Dnm3 UTSW 1 162353574 missense probably benign 0.06
R1680:Dnm3 UTSW 1 162010976 missense probably benign 0.12
R1747:Dnm3 UTSW 1 162313584 missense probably damaging 1.00
R1881:Dnm3 UTSW 1 162477948 start gained probably benign
R1997:Dnm3 UTSW 1 162353712 missense possibly damaging 0.60
R2157:Dnm3 UTSW 1 162307893 missense possibly damaging 0.95
R2270:Dnm3 UTSW 1 162477789 missense probably damaging 1.00
R2897:Dnm3 UTSW 1 162286074 splice site probably benign
R3018:Dnm3 UTSW 1 162321759 nonsense probably null
R3851:Dnm3 UTSW 1 162321127 splice site probably null
R3861:Dnm3 UTSW 1 162311405 missense possibly damaging 0.79
R3930:Dnm3 UTSW 1 162084130 missense probably damaging 1.00
R4432:Dnm3 UTSW 1 161991997 intron probably benign
R5318:Dnm3 UTSW 1 162011807 nonsense probably null
R5361:Dnm3 UTSW 1 162010902 missense probably damaging 0.99
R5606:Dnm3 UTSW 1 162286018 missense probably damaging 0.99
R5783:Dnm3 UTSW 1 162355471 missense possibly damaging 0.70
R6019:Dnm3 UTSW 1 162134501 missense probably damaging 0.99
R6072:Dnm3 UTSW 1 162011068 small deletion probably benign
R6086:Dnm3 UTSW 1 162321033 missense probably damaging 0.99
R6110:Dnm3 UTSW 1 162011068 small deletion probably benign
R6158:Dnm3 UTSW 1 162320987 missense probably damaging 0.98
R6473:Dnm3 UTSW 1 162477705 missense probably damaging 1.00
R6499:Dnm3 UTSW 1 162313595 missense probably damaging 1.00
R6702:Dnm3 UTSW 1 162318687 missense probably benign 0.04
R6703:Dnm3 UTSW 1 162318687 missense probably benign 0.04
R6739:Dnm3 UTSW 1 162477783 missense probably damaging 0.99
R6811:Dnm3 UTSW 1 162321083 missense probably damaging 0.96
R6915:Dnm3 UTSW 1 162318397 intron probably null
R6946:Dnm3 UTSW 1 162313655 missense possibly damaging 0.91
R7062:Dnm3 UTSW 1 162134491 nonsense probably null
R7071:Dnm3 UTSW 1 162019843 missense probably damaging 0.99
R7521:Dnm3 UTSW 1 162134544 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTGTTCCTAAATCGGAGTGTG -3'
(R):5'- TGCCAAATCCCATGGGTTTG -3'

Sequencing Primer
(F):5'- GTGGTCTAAATAATGGTAAATGGCC -3'
(R):5'- CAAATCCCATGGGTTTGTGTTTC -3'
Posted On2019-05-13