Mutagenetix > Incidental Mutation

Incidental Mutation 'R7067:Hnrnpr'

548615

Institutional Source

Beutler Lab

Gene Symbol

Hnrnpr

Ensembl Gene

ENSMUSG00000066037

Gene Name

heterogeneous nuclear ribonucleoprotein R

Synonyms

hnRNPR, Hnrpr, 2610528B01Rik, 2610003J05Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7067 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

136310942-136359447 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 136327393 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 219 (A219V)

Ref Sequence

ENSEMBL: ENSMUSP00000138399 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084219] [ENSMUST00000105850] [ENSMUST00000125696] [ENSMUST00000131671] [ENSMUST00000134524] [ENSMUST00000145282] [ENSMUST00000148843]

AlphaFold

Q8VHM5

Predicted Effect

probably damaging
Transcript: ENSMUST00000084219
AA Change: A118V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000081239
Gene: ENSMUSG00000066037
AA Change: A118V

Domain	Start	End	E-Value	Type
RRM	166	240	1.27e-16	SMART
RRM	247	324	9.42e-11	SMART
RRM	342	407	3.76e-19	SMART
low complexity region	419	428	N/A	INTRINSIC
low complexity region	433	496	N/A	INTRINSIC
low complexity region	499	527	N/A	INTRINSIC
low complexity region	531	574	N/A	INTRINSIC
low complexity region	604	620	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000105850
AA Change: A219V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101476
Gene: ENSMUSG00000066037
AA Change: A219V

Domain	Start	End	E-Value	Type
RRM	166	240	1.27e-16	SMART
RRM	247	324	9.42e-11	SMART
RRM	342	407	3.76e-19	SMART
low complexity region	419	428	N/A	INTRINSIC
low complexity region	433	496	N/A	INTRINSIC
low complexity region	499	527	N/A	INTRINSIC
low complexity region	531	574	N/A	INTRINSIC
low complexity region	604	620	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000125696

Predicted Effect

probably damaging
Transcript: ENSMUST00000131671
AA Change: A118V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000138263
Gene: ENSMUSG00000066037
AA Change: A118V

Domain	Start	End	E-Value	Type
RRM	65	139	1.27e-16	SMART
RRM	146	223	9.42e-11	SMART
RRM	241	306	3.76e-19	SMART
low complexity region	318	327	N/A	INTRINSIC
low complexity region	332	395	N/A	INTRINSIC
low complexity region	398	426	N/A	INTRINSIC
low complexity region	430	473	N/A	INTRINSIC
low complexity region	503	519	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000134524
AA Change: A219V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000119666
Gene: ENSMUSG00000066037
AA Change: A219V

Domain	Start	End	E-Value	Type
RRM	166	240	1.27e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000145282

Predicted Effect

probably damaging
Transcript: ENSMUST00000148843
AA Change: A219V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000138399
Gene: ENSMUSG00000066037
AA Change: A219V

Domain	Start	End	E-Value	Type
RRM	166	240	1.27e-16	SMART
RRM	247	324	9.42e-11	SMART
RRM	342	407	3.76e-19	SMART
low complexity region	419	428	N/A	INTRINSIC
low complexity region	433	496	N/A	INTRINSIC
low complexity region	499	527	N/A	INTRINSIC
low complexity region	531	574	N/A	INTRINSIC
low complexity region	604	620	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

98% (62/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that is a member of the spliceosome C complex, which functions in pre-mRNA processing and transport. The encoded protein also promotes transcription at the c-fos gene. Alternative splicing results in multiple transcript variants. There are pseudogenes for this gene on chromosomes 4, 11, and 10. [provided by RefSeq, Jul 2014]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438H23Rik	T	A	16: 91,056,033	S72C	probably damaging	Het
9330182L06Rik	G	T	5: 9,266,295	A9S	possibly damaging	Het
Abca13	A	G	11: 9,291,845	D1236G	probably benign	Het
Abcc6	T	C	7: 46,018,690	N165D	probably benign	Het
Aebp1	A	G	11: 5,866,431		probably null	Het
Anapc4	A	G	5: 52,862,235	T580A	probably benign	Het
Apob	T	C	12: 8,009,423	I2602T	probably damaging	Het
Arap2	A	G	5: 62,654,044		probably null	Het
Asap3	T	A	4: 136,241,362		probably null	Het
Bend4	A	G	5: 67,400,268	Y402H	probably damaging	Het
Crtc2	A	G	3: 90,260,182	N271S	probably benign	Het
Csf2rb2	A	T	15: 78,292,494	W233R	probably damaging	Het
Ctgf	A	G	10: 24,596,975	Y261C	probably benign	Het
Cyp2u1	G	A	3: 131,293,553	L460F	probably damaging	Het
Dnm3	A	G	1: 162,320,971	L277P	probably damaging	Het
Efemp1	A	T	11: 28,867,926	N135I	probably damaging	Het
Fsip2	T	A	2: 82,980,734	S2466T	possibly damaging	Het
Gal3st2	C	T	1: 93,874,725	A276V	possibly damaging	Het
Gm47985	A	T	1: 151,183,490	D294V	unknown	Het
Golga1	A	T	2: 39,047,719	D104E	probably benign	Het
Hsd3b7	T	C	7: 127,800,716		probably null	Het
Hspa8	T	C	9: 40,804,625	I562T	probably damaging	Het
Htra4	C	T	8: 25,033,701	V283M	probably damaging	Het
Il1f5	C	T	2: 24,277,529	R11*	probably null	Het
Iqcd	A	G	5: 120,605,147	T325A	probably damaging	Het
Kif23	A	T	9: 61,924,989	M624K	probably benign	Het
Krt25	G	T	11: 99,317,383	Q340K	probably benign	Het
Lamp3	T	A	16: 19,699,663	N275Y	probably damaging	Het
Lpin2	A	C	17: 71,244,858	K789T	possibly damaging	Het
Mroh2b	T	C	15: 4,900,504	I24T	probably benign	Het
Muc16	T	A	9: 18,658,251	I991F	unknown	Het
Ntf5	T	A	7: 45,415,624	L60Q	probably damaging	Het
Nuak1	A	G	10: 84,440,294	S22P	possibly damaging	Het
Obox8	T	C	7: 14,333,054	T22A	possibly damaging	Het
Olfr1053	T	A	2: 86,314,567	T240S	probably damaging	Het
Pde8a	T	C	7: 81,317,326	V405A	probably benign	Het
Phc2	T	C	4: 128,747,141	S147P	probably benign	Het
Pole	G	T	5: 110,334,218	G142V	probably damaging	Het
Poli	G	A	18: 70,509,417	Q508*	probably null	Het
Repin1	T	A	6: 48,597,916	L537*	probably null	Het
Rictor	C	T	15: 6,772,154	S441L	probably benign	Het
Samd7	G	C	3: 30,751,123	K18N	probably benign	Het
Slc30a2	T	A	4: 134,344,218		probably null	Het
Slit3	A	G	11: 35,508,230	S141G	probably benign	Het
Spata5	C	T	3: 37,431,698	Q190*	probably null	Het
Spon2	A	G	5: 33,214,614	S283P	probably damaging	Het
Srgap3	A	T	6: 112,757,305		probably benign	Het
Syde2	A	G	3: 145,988,264	D89G	probably benign	Het
Syne1	A	G	10: 5,234,586	I4099T	probably damaging	Het
Syt5	T	C	7: 4,543,076	D105G	probably benign	Het
Tlx3	C	T	11: 33,203,204	G86S	probably damaging	Het
Trim24	A	T	6: 37,957,840		probably null	Het
Umodl1	G	A	17: 30,982,272	V392I	probably damaging	Het
Unc80	C	A	1: 66,646,572	T2285K	possibly damaging	Het
Vars	G	A	17: 35,011,479	V513I	probably damaging	Het
Vmn1r87	T	A	7: 13,131,922	Q146L	probably benign	Het
Vmn2r62	T	C	7: 42,764,878	I714V	probably benign	Het
Xbp1	T	A	11: 5,524,275	S159T	probably damaging	Het
Xrn1	T	A	9: 95,969,512	H194Q	probably damaging	Het
Zc3h4	A	T	7: 16,429,051	K459*	probably null	Het
Zdhhc6	G	A	19: 55,304,439	R292*	probably null	Het
Zfp383	T	A	7: 29,908,646	M1K	probably null	Het
Zfp703	A	G	8: 26,979,016	D236G	probably damaging	Het

Other mutations in Hnrnpr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00778:Hnrnpr	APN	4	136339545	missense	unknown
IGL00844:Hnrnpr	APN	4	136339205	missense	probably benign	0.17
IGL01374:Hnrnpr	APN	4	136327418	splice site	probably benign
IGL01704:Hnrnpr	APN	4	136329381	missense	possibly damaging	0.89
IGL01825:Hnrnpr	APN	4	136339539	nonsense	probably null
IGL01843:Hnrnpr	APN	4	136339413	splice site	probably benign
IGL01871:Hnrnpr	APN	4	136339574	missense	unknown
IGL02376:Hnrnpr	APN	4	136319455	missense	probably damaging	1.00
IGL02557:Hnrnpr	APN	4	136319506	missense	probably damaging	1.00
IGL02947:Hnrnpr	APN	4	136316379	missense	probably damaging	1.00
PIT4677001:Hnrnpr	UTSW	4	136329439	missense	probably damaging	1.00
R0142:Hnrnpr	UTSW	4	136327282	missense	probably damaging	1.00
R0219:Hnrnpr	UTSW	4	136339163	splice site	probably benign
R1459:Hnrnpr	UTSW	4	136329444	missense	probably damaging	1.00
R1917:Hnrnpr	UTSW	4	136332488	nonsense	probably null
R2007:Hnrnpr	UTSW	4	136319513	unclassified	probably benign
R2364:Hnrnpr	UTSW	4	136327329	missense	possibly damaging	0.69
R3788:Hnrnpr	UTSW	4	136336313	missense	probably damaging	1.00
R4066:Hnrnpr	UTSW	4	136339346	intron	probably benign
R4232:Hnrnpr	UTSW	4	136339189	missense	probably benign	0.15
R4433:Hnrnpr	UTSW	4	136317148	missense	probably benign	0.04
R4664:Hnrnpr	UTSW	4	136317175	unclassified	probably benign
R4990:Hnrnpr	UTSW	4	136329379	missense	probably damaging	1.00
R4990:Hnrnpr	UTSW	4	136336298	missense	probably damaging	1.00
R5058:Hnrnpr	UTSW	4	136336337	missense	possibly damaging	0.89
R5328:Hnrnpr	UTSW	4	136339216	missense	probably benign	0.01
R5469:Hnrnpr	UTSW	4	136319434	missense	probably damaging	1.00
R5641:Hnrnpr	UTSW	4	136332487	missense	probably damaging	0.97
R7250:Hnrnpr	UTSW	4	136332435	missense	probably benign	0.45
R7254:Hnrnpr	UTSW	4	136332575	missense	possibly damaging	0.92
R8213:Hnrnpr	UTSW	4	136317175	unclassified	probably benign
R8942:Hnrnpr	UTSW	4	136332480	missense	possibly damaging	0.95
R9008:Hnrnpr	UTSW	4	136329426	missense	probably damaging	0.97
R9502:Hnrnpr	UTSW	4	136329370	missense	probably damaging	0.99
R9515:Hnrnpr	UTSW	4	136336304	missense	probably damaging	1.00
R9516:Hnrnpr	UTSW	4	136336304	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGGAAGTCTGACTCTGGTTC -3'
(R):5'- GTACCAATTCTAAAGCTCGACAG -3'

Sequencing Primer
(F):5'- GACTCTGGTTCTAAAATGAAGAGTGC -3'
(R):5'- CATACTAACCAACCTTGTTAGCTTAG -3'

Posted On

2019-05-13