Incidental Mutation 'R7067:Hnrnpr'
ID 548615
Institutional Source Beutler Lab
Gene Symbol Hnrnpr
Ensembl Gene ENSMUSG00000066037
Gene Name heterogeneous nuclear ribonucleoprotein R
Synonyms hnRNPR, Hnrpr, 2610528B01Rik, 2610003J05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7067 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 136310942-136359447 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 136327393 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 219 (A219V)
Ref Sequence ENSEMBL: ENSMUSP00000138399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084219] [ENSMUST00000105850] [ENSMUST00000125696] [ENSMUST00000131671] [ENSMUST00000134524] [ENSMUST00000145282] [ENSMUST00000148843]
AlphaFold Q8VHM5
Predicted Effect probably damaging
Transcript: ENSMUST00000084219
AA Change: A118V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081239
Gene: ENSMUSG00000066037
AA Change: A118V

DomainStartEndE-ValueType
RRM 166 240 1.27e-16 SMART
RRM 247 324 9.42e-11 SMART
RRM 342 407 3.76e-19 SMART
low complexity region 419 428 N/A INTRINSIC
low complexity region 433 496 N/A INTRINSIC
low complexity region 499 527 N/A INTRINSIC
low complexity region 531 574 N/A INTRINSIC
low complexity region 604 620 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105850
AA Change: A219V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101476
Gene: ENSMUSG00000066037
AA Change: A219V

DomainStartEndE-ValueType
RRM 166 240 1.27e-16 SMART
RRM 247 324 9.42e-11 SMART
RRM 342 407 3.76e-19 SMART
low complexity region 419 428 N/A INTRINSIC
low complexity region 433 496 N/A INTRINSIC
low complexity region 499 527 N/A INTRINSIC
low complexity region 531 574 N/A INTRINSIC
low complexity region 604 620 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125696
Predicted Effect probably damaging
Transcript: ENSMUST00000131671
AA Change: A118V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138263
Gene: ENSMUSG00000066037
AA Change: A118V

DomainStartEndE-ValueType
RRM 65 139 1.27e-16 SMART
RRM 146 223 9.42e-11 SMART
RRM 241 306 3.76e-19 SMART
low complexity region 318 327 N/A INTRINSIC
low complexity region 332 395 N/A INTRINSIC
low complexity region 398 426 N/A INTRINSIC
low complexity region 430 473 N/A INTRINSIC
low complexity region 503 519 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000134524
AA Change: A219V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119666
Gene: ENSMUSG00000066037
AA Change: A219V

DomainStartEndE-ValueType
RRM 166 240 1.27e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145282
Predicted Effect probably damaging
Transcript: ENSMUST00000148843
AA Change: A219V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138399
Gene: ENSMUSG00000066037
AA Change: A219V

DomainStartEndE-ValueType
RRM 166 240 1.27e-16 SMART
RRM 247 324 9.42e-11 SMART
RRM 342 407 3.76e-19 SMART
low complexity region 419 428 N/A INTRINSIC
low complexity region 433 496 N/A INTRINSIC
low complexity region 499 527 N/A INTRINSIC
low complexity region 531 574 N/A INTRINSIC
low complexity region 604 620 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that is a member of the spliceosome C complex, which functions in pre-mRNA processing and transport. The encoded protein also promotes transcription at the c-fos gene. Alternative splicing results in multiple transcript variants. There are pseudogenes for this gene on chromosomes 4, 11, and 10. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik T A 16: 91,056,033 S72C probably damaging Het
9330182L06Rik G T 5: 9,266,295 A9S possibly damaging Het
Abca13 A G 11: 9,291,845 D1236G probably benign Het
Abcc6 T C 7: 46,018,690 N165D probably benign Het
Aebp1 A G 11: 5,866,431 probably null Het
Anapc4 A G 5: 52,862,235 T580A probably benign Het
Apob T C 12: 8,009,423 I2602T probably damaging Het
Arap2 A G 5: 62,654,044 probably null Het
Asap3 T A 4: 136,241,362 probably null Het
Bend4 A G 5: 67,400,268 Y402H probably damaging Het
Crtc2 A G 3: 90,260,182 N271S probably benign Het
Csf2rb2 A T 15: 78,292,494 W233R probably damaging Het
Ctgf A G 10: 24,596,975 Y261C probably benign Het
Cyp2u1 G A 3: 131,293,553 L460F probably damaging Het
Dnm3 A G 1: 162,320,971 L277P probably damaging Het
Efemp1 A T 11: 28,867,926 N135I probably damaging Het
Fsip2 T A 2: 82,980,734 S2466T possibly damaging Het
Gal3st2 C T 1: 93,874,725 A276V possibly damaging Het
Gm47985 A T 1: 151,183,490 D294V unknown Het
Golga1 A T 2: 39,047,719 D104E probably benign Het
Hsd3b7 T C 7: 127,800,716 probably null Het
Hspa8 T C 9: 40,804,625 I562T probably damaging Het
Htra4 C T 8: 25,033,701 V283M probably damaging Het
Il1f5 C T 2: 24,277,529 R11* probably null Het
Iqcd A G 5: 120,605,147 T325A probably damaging Het
Kif23 A T 9: 61,924,989 M624K probably benign Het
Krt25 G T 11: 99,317,383 Q340K probably benign Het
Lamp3 T A 16: 19,699,663 N275Y probably damaging Het
Lpin2 A C 17: 71,244,858 K789T possibly damaging Het
Mroh2b T C 15: 4,900,504 I24T probably benign Het
Muc16 T A 9: 18,658,251 I991F unknown Het
Ntf5 T A 7: 45,415,624 L60Q probably damaging Het
Nuak1 A G 10: 84,440,294 S22P possibly damaging Het
Obox8 T C 7: 14,333,054 T22A possibly damaging Het
Olfr1053 T A 2: 86,314,567 T240S probably damaging Het
Pde8a T C 7: 81,317,326 V405A probably benign Het
Phc2 T C 4: 128,747,141 S147P probably benign Het
Pole G T 5: 110,334,218 G142V probably damaging Het
Poli G A 18: 70,509,417 Q508* probably null Het
Repin1 T A 6: 48,597,916 L537* probably null Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Samd7 G C 3: 30,751,123 K18N probably benign Het
Slc30a2 T A 4: 134,344,218 probably null Het
Slit3 A G 11: 35,508,230 S141G probably benign Het
Spata5 C T 3: 37,431,698 Q190* probably null Het
Spon2 A G 5: 33,214,614 S283P probably damaging Het
Srgap3 A T 6: 112,757,305 probably benign Het
Syde2 A G 3: 145,988,264 D89G probably benign Het
Syne1 A G 10: 5,234,586 I4099T probably damaging Het
Syt5 T C 7: 4,543,076 D105G probably benign Het
Tlx3 C T 11: 33,203,204 G86S probably damaging Het
Trim24 A T 6: 37,957,840 probably null Het
Umodl1 G A 17: 30,982,272 V392I probably damaging Het
Unc80 C A 1: 66,646,572 T2285K possibly damaging Het
Vars G A 17: 35,011,479 V513I probably damaging Het
Vmn1r87 T A 7: 13,131,922 Q146L probably benign Het
Vmn2r62 T C 7: 42,764,878 I714V probably benign Het
Xbp1 T A 11: 5,524,275 S159T probably damaging Het
Xrn1 T A 9: 95,969,512 H194Q probably damaging Het
Zc3h4 A T 7: 16,429,051 K459* probably null Het
Zdhhc6 G A 19: 55,304,439 R292* probably null Het
Zfp383 T A 7: 29,908,646 M1K probably null Het
Zfp703 A G 8: 26,979,016 D236G probably damaging Het
Other mutations in Hnrnpr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Hnrnpr APN 4 136339545 missense unknown
IGL00844:Hnrnpr APN 4 136339205 missense probably benign 0.17
IGL01374:Hnrnpr APN 4 136327418 splice site probably benign
IGL01704:Hnrnpr APN 4 136329381 missense possibly damaging 0.89
IGL01825:Hnrnpr APN 4 136339539 nonsense probably null
IGL01843:Hnrnpr APN 4 136339413 splice site probably benign
IGL01871:Hnrnpr APN 4 136339574 missense unknown
IGL02376:Hnrnpr APN 4 136319455 missense probably damaging 1.00
IGL02557:Hnrnpr APN 4 136319506 missense probably damaging 1.00
IGL02947:Hnrnpr APN 4 136316379 missense probably damaging 1.00
PIT4677001:Hnrnpr UTSW 4 136329439 missense probably damaging 1.00
R0142:Hnrnpr UTSW 4 136327282 missense probably damaging 1.00
R0219:Hnrnpr UTSW 4 136339163 splice site probably benign
R1459:Hnrnpr UTSW 4 136329444 missense probably damaging 1.00
R1917:Hnrnpr UTSW 4 136332488 nonsense probably null
R2007:Hnrnpr UTSW 4 136319513 unclassified probably benign
R2364:Hnrnpr UTSW 4 136327329 missense possibly damaging 0.69
R3788:Hnrnpr UTSW 4 136336313 missense probably damaging 1.00
R4066:Hnrnpr UTSW 4 136339346 intron probably benign
R4232:Hnrnpr UTSW 4 136339189 missense probably benign 0.15
R4433:Hnrnpr UTSW 4 136317148 missense probably benign 0.04
R4664:Hnrnpr UTSW 4 136317175 unclassified probably benign
R4990:Hnrnpr UTSW 4 136329379 missense probably damaging 1.00
R4990:Hnrnpr UTSW 4 136336298 missense probably damaging 1.00
R5058:Hnrnpr UTSW 4 136336337 missense possibly damaging 0.89
R5328:Hnrnpr UTSW 4 136339216 missense probably benign 0.01
R5469:Hnrnpr UTSW 4 136319434 missense probably damaging 1.00
R5641:Hnrnpr UTSW 4 136332487 missense probably damaging 0.97
R7250:Hnrnpr UTSW 4 136332435 missense probably benign 0.45
R7254:Hnrnpr UTSW 4 136332575 missense possibly damaging 0.92
R8213:Hnrnpr UTSW 4 136317175 unclassified probably benign
R8942:Hnrnpr UTSW 4 136332480 missense possibly damaging 0.95
R9008:Hnrnpr UTSW 4 136329426 missense probably damaging 0.97
R9502:Hnrnpr UTSW 4 136329370 missense probably damaging 0.99
R9515:Hnrnpr UTSW 4 136336304 missense probably damaging 1.00
R9516:Hnrnpr UTSW 4 136336304 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGAAGTCTGACTCTGGTTC -3'
(R):5'- GTACCAATTCTAAAGCTCGACAG -3'

Sequencing Primer
(F):5'- GACTCTGGTTCTAAAATGAAGAGTGC -3'
(R):5'- CATACTAACCAACCTTGTTAGCTTAG -3'
Posted On 2019-05-13