Incidental Mutation 'R7067:Anapc4'
ID548618
Institutional Source Beutler Lab
Gene Symbol Anapc4
Ensembl Gene ENSMUSG00000029176
Gene Nameanaphase promoting complex subunit 4
Synonyms2610306D21Rik, D5Ertd249e, APC4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7067 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location52834012-52867797 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52862235 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 580 (T580A)
Ref Sequence ENSEMBL: ENSMUSP00000031072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031072] [ENSMUST00000144574]
Predicted Effect probably benign
Transcript: ENSMUST00000031072
AA Change: T580A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031072
Gene: ENSMUSG00000029176
AA Change: T580A

DomainStartEndE-ValueType
Pfam:ANAPC4_WD40 10 57 9.1e-18 PFAM
low complexity region 137 147 N/A INTRINSIC
Pfam:ANAPC4 232 431 3.7e-61 PFAM
low complexity region 747 763 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144574
SMART Domains Protein: ENSMUSP00000114475
Gene: ENSMUSG00000029176

DomainStartEndE-ValueType
Pfam:Apc4_WD40 10 57 4e-20 PFAM
Meta Mutation Damage Score 0.0613 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A large protein complex, termed the anaphase-promoting complex (APC), or the cyclosome, promotes metaphase-anaphase transition by ubiquitinating its specific substrates such as mitotic cyclins and anaphase inhibitor, which are subsequently degraded by the 26S proteasome. Biochemical studies have shown that the vertebrate APC contains eight subunits. The composition of the APC is highly conserved in organisms from yeast to humans. The exact function of this gene product is not known. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik T A 16: 91,056,033 S72C probably damaging Het
9330182L06Rik G T 5: 9,266,295 A9S possibly damaging Het
Abca13 A G 11: 9,291,845 D1236G probably benign Het
Abcc6 T C 7: 46,018,690 N165D probably benign Het
Aebp1 A G 11: 5,866,431 probably null Het
Apob T C 12: 8,009,423 I2602T probably damaging Het
Arap2 A G 5: 62,654,044 probably null Het
Asap3 T A 4: 136,241,362 probably null Het
Bend4 A G 5: 67,400,268 Y402H probably damaging Het
Crtc2 A G 3: 90,260,182 N271S probably benign Het
Csf2rb2 A T 15: 78,292,494 W233R probably damaging Het
Ctgf A G 10: 24,596,975 Y261C probably benign Het
Cyp2u1 G A 3: 131,293,553 L460F probably damaging Het
Dnm3 A G 1: 162,320,971 L277P probably damaging Het
Efemp1 A T 11: 28,867,926 N135I probably damaging Het
Fsip2 T A 2: 82,980,734 S2466T possibly damaging Het
Gal3st2 C T 1: 93,874,725 A276V possibly damaging Het
Gm47985 A T 1: 151,183,490 D294V unknown Het
Golga1 A T 2: 39,047,719 D104E probably benign Het
Hnrnpr C T 4: 136,327,393 A219V probably damaging Het
Hsd3b7 T C 7: 127,800,716 probably null Het
Hspa8 T C 9: 40,804,625 I562T probably damaging Het
Htra4 C T 8: 25,033,701 V283M probably damaging Het
Il1f5 C T 2: 24,277,529 R11* probably null Het
Iqcd A G 5: 120,605,147 T325A probably damaging Het
Kif23 A T 9: 61,924,989 M624K probably benign Het
Krt25 G T 11: 99,317,383 Q340K probably benign Het
Lamp3 T A 16: 19,699,663 N275Y probably damaging Het
Lpin2 A C 17: 71,244,858 K789T possibly damaging Het
Mroh2b T C 15: 4,900,504 I24T probably benign Het
Muc16 T A 9: 18,658,251 I991F unknown Het
Ntf5 T A 7: 45,415,624 L60Q probably damaging Het
Nuak1 A G 10: 84,440,294 S22P possibly damaging Het
Obox8 T C 7: 14,333,054 T22A possibly damaging Het
Olfr1053 T A 2: 86,314,567 T240S probably damaging Het
Pde8a T C 7: 81,317,326 V405A probably benign Het
Phc2 T C 4: 128,747,141 S147P probably benign Het
Pole G T 5: 110,334,218 G142V probably damaging Het
Poli G A 18: 70,509,417 Q508* probably null Het
Repin1 T A 6: 48,597,916 L537* probably null Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Samd7 G C 3: 30,751,123 K18N probably benign Het
Slc30a2 T A 4: 134,344,218 probably null Het
Slit3 A G 11: 35,508,230 S141G probably benign Het
Spata5 C T 3: 37,431,698 Q190* probably null Het
Spon2 A G 5: 33,214,614 S283P probably damaging Het
Srgap3 A T 6: 112,757,305 probably benign Het
Syde2 A G 3: 145,988,264 D89G probably benign Het
Syne1 A G 10: 5,234,586 I4099T probably damaging Het
Syt5 T C 7: 4,543,076 D105G probably benign Het
Tlx3 C T 11: 33,203,204 G86S probably damaging Het
Trim24 A T 6: 37,957,840 probably null Het
Umodl1 G A 17: 30,982,272 V392I probably damaging Het
Unc80 C A 1: 66,646,572 T2285K possibly damaging Het
Vars G A 17: 35,011,479 V513I probably damaging Het
Vmn1r87 T A 7: 13,131,922 Q146L probably benign Het
Vmn2r62 T C 7: 42,764,878 I714V probably benign Het
Xbp1 T A 11: 5,524,275 S159T probably damaging Het
Xrn1 T A 9: 95,969,512 H194Q probably damaging Het
Zc3h4 A T 7: 16,429,051 K459* probably null Het
Zdhhc6 G A 19: 55,304,439 R292* probably null Het
Zfp383 T A 7: 29,908,646 M1K probably null Het
Zfp703 A G 8: 26,979,016 D236G probably damaging Het
Other mutations in Anapc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Anapc4 APN 5 52857211 missense probably damaging 0.98
IGL01066:Anapc4 APN 5 52857209 missense probably benign 0.08
IGL01109:Anapc4 APN 5 52848628 missense probably damaging 1.00
IGL01657:Anapc4 APN 5 52864626 nonsense probably null
IGL02692:Anapc4 APN 5 52864529 missense probably damaging 0.98
IGL02734:Anapc4 APN 5 52861291 missense probably benign 0.04
IGL03089:Anapc4 APN 5 52866398 missense probably benign 0.32
IGL03096:Anapc4 APN 5 52865929 missense possibly damaging 0.57
FR4304:Anapc4 UTSW 5 52864526 missense probably damaging 1.00
IGL03048:Anapc4 UTSW 5 52839733 missense probably benign 0.00
R0331:Anapc4 UTSW 5 52855642 splice site probably benign
R0511:Anapc4 UTSW 5 52842017 unclassified probably benign
R0624:Anapc4 UTSW 5 52845419 splice site probably benign
R0919:Anapc4 UTSW 5 52855637 missense probably benign 0.18
R1935:Anapc4 UTSW 5 52839668 missense probably damaging 0.99
R1936:Anapc4 UTSW 5 52839668 missense probably damaging 0.99
R1942:Anapc4 UTSW 5 52846714 missense probably benign 0.30
R1953:Anapc4 UTSW 5 52839688 missense probably damaging 1.00
R1954:Anapc4 UTSW 5 52846625 intron probably benign
R2341:Anapc4 UTSW 5 52841937 unclassified probably benign
R3696:Anapc4 UTSW 5 52862009 missense probably null 0.01
R4506:Anapc4 UTSW 5 52835730 missense possibly damaging 0.79
R4596:Anapc4 UTSW 5 52841718 missense probably benign 0.00
R5234:Anapc4 UTSW 5 52848776 missense probably damaging 1.00
R5256:Anapc4 UTSW 5 52863594 missense probably benign
R5310:Anapc4 UTSW 5 52859159 missense probably benign 0.00
R5401:Anapc4 UTSW 5 52863649 missense probably benign 0.01
R5409:Anapc4 UTSW 5 52848599 missense probably damaging 0.98
R5525:Anapc4 UTSW 5 52856809 missense probably damaging 1.00
R5575:Anapc4 UTSW 5 52855871 missense probably damaging 1.00
R5604:Anapc4 UTSW 5 52841734 nonsense probably null
R5695:Anapc4 UTSW 5 52862239 missense probably benign 0.00
R5955:Anapc4 UTSW 5 52865946 missense probably benign 0.01
R5974:Anapc4 UTSW 5 52845400 missense probably damaging 1.00
R6458:Anapc4 UTSW 5 52864553 missense possibly damaging 0.80
R6537:Anapc4 UTSW 5 52843556 missense probably damaging 0.98
R6633:Anapc4 UTSW 5 52865946 missense possibly damaging 0.85
R6860:Anapc4 UTSW 5 52848828 missense probably damaging 1.00
R6965:Anapc4 UTSW 5 52835751 missense possibly damaging 0.89
R7327:Anapc4 UTSW 5 52845330 missense probably damaging 0.99
R7442:Anapc4 UTSW 5 52857201 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GGAAGATCGATGAATCAAGCAATTTGC -3'
(R):5'- CCAGGAGGTTAACATCACTAAAACATG -3'

Sequencing Primer
(F):5'- GGTAATTCTCTTTACCCATTGTAAGC -3'
(R):5'- CTCGGCAGTTAAAAGCACTTG -3'
Posted On2019-05-13