Incidental Mutation 'R7067:Vmn1r87'
ID548625
Institutional Source Beutler Lab
Gene Symbol Vmn1r87
Ensembl Gene ENSMUSG00000070815
Gene Namevomeronasal 1 receptor 87
SynonymsV1rk1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R7067 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location13130904-13140157 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13131922 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 146 (Q146L)
Ref Sequence ENSEMBL: ENSMUSP00000154184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094827] [ENSMUST00000211249] [ENSMUST00000227443] [ENSMUST00000228800]
Predicted Effect probably benign
Transcript: ENSMUST00000094827
AA Change: Q146L

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000092422
Gene: ENSMUSG00000070815
AA Change: Q146L

DomainStartEndE-ValueType
Pfam:TAS2R 1 285 1.2e-11 PFAM
Pfam:V1R 14 280 1.8e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211249
AA Change: Q146L

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000227443
AA Change: Q146L

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000228800
AA Change: Q146L

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
Meta Mutation Damage Score 0.138 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik T A 16: 91,056,033 S72C probably damaging Het
9330182L06Rik G T 5: 9,266,295 A9S possibly damaging Het
Abca13 A G 11: 9,291,845 D1236G probably benign Het
Abcc6 T C 7: 46,018,690 N165D probably benign Het
Aebp1 A G 11: 5,866,431 probably null Het
Anapc4 A G 5: 52,862,235 T580A probably benign Het
Apob T C 12: 8,009,423 I2602T probably damaging Het
Arap2 A G 5: 62,654,044 probably null Het
Asap3 T A 4: 136,241,362 probably null Het
Bend4 A G 5: 67,400,268 Y402H probably damaging Het
Crtc2 A G 3: 90,260,182 N271S probably benign Het
Csf2rb2 A T 15: 78,292,494 W233R probably damaging Het
Ctgf A G 10: 24,596,975 Y261C probably benign Het
Cyp2u1 G A 3: 131,293,553 L460F probably damaging Het
Dnm3 A G 1: 162,320,971 L277P probably damaging Het
Efemp1 A T 11: 28,867,926 N135I probably damaging Het
Fsip2 T A 2: 82,980,734 S2466T possibly damaging Het
Gal3st2 C T 1: 93,874,725 A276V possibly damaging Het
Gm47985 A T 1: 151,183,490 D294V unknown Het
Golga1 A T 2: 39,047,719 D104E probably benign Het
Hnrnpr C T 4: 136,327,393 A219V probably damaging Het
Hsd3b7 T C 7: 127,800,716 probably null Het
Hspa8 T C 9: 40,804,625 I562T probably damaging Het
Htra4 C T 8: 25,033,701 V283M probably damaging Het
Il1f5 C T 2: 24,277,529 R11* probably null Het
Iqcd A G 5: 120,605,147 T325A probably damaging Het
Kif23 A T 9: 61,924,989 M624K probably benign Het
Krt25 G T 11: 99,317,383 Q340K probably benign Het
Lamp3 T A 16: 19,699,663 N275Y probably damaging Het
Lpin2 A C 17: 71,244,858 K789T possibly damaging Het
Mroh2b T C 15: 4,900,504 I24T probably benign Het
Muc16 T A 9: 18,658,251 I991F unknown Het
Ntf5 T A 7: 45,415,624 L60Q probably damaging Het
Nuak1 A G 10: 84,440,294 S22P possibly damaging Het
Obox8 T C 7: 14,333,054 T22A possibly damaging Het
Olfr1053 T A 2: 86,314,567 T240S probably damaging Het
Pde8a T C 7: 81,317,326 V405A probably benign Het
Phc2 T C 4: 128,747,141 S147P probably benign Het
Pole G T 5: 110,334,218 G142V probably damaging Het
Poli G A 18: 70,509,417 Q508* probably null Het
Repin1 T A 6: 48,597,916 L537* probably null Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Samd7 G C 3: 30,751,123 K18N probably benign Het
Slc30a2 T A 4: 134,344,218 probably null Het
Slit3 A G 11: 35,508,230 S141G probably benign Het
Spata5 C T 3: 37,431,698 Q190* probably null Het
Spon2 A G 5: 33,214,614 S283P probably damaging Het
Srgap3 A T 6: 112,757,305 probably benign Het
Syde2 A G 3: 145,988,264 D89G probably benign Het
Syne1 A G 10: 5,234,586 I4099T probably damaging Het
Syt5 T C 7: 4,543,076 D105G probably benign Het
Tlx3 C T 11: 33,203,204 G86S probably damaging Het
Trim24 A T 6: 37,957,840 probably null Het
Umodl1 G A 17: 30,982,272 V392I probably damaging Het
Unc80 C A 1: 66,646,572 T2285K possibly damaging Het
Vars G A 17: 35,011,479 V513I probably damaging Het
Vmn2r62 T C 7: 42,764,878 I714V probably benign Het
Xbp1 T A 11: 5,524,275 S159T probably damaging Het
Xrn1 T A 9: 95,969,512 H194Q probably damaging Het
Zc3h4 A T 7: 16,429,051 K459* probably null Het
Zdhhc6 G A 19: 55,304,439 R292* probably null Het
Zfp383 T A 7: 29,908,646 M1K probably null Het
Zfp703 A G 8: 26,979,016 D236G probably damaging Het
Other mutations in Vmn1r87
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01400:Vmn1r87 APN 7 13132303 missense probably damaging 1.00
IGL01577:Vmn1r87 APN 7 13131848 missense probably benign 0.00
IGL02972:Vmn1r87 APN 7 13132329 nonsense probably null
IGL03246:Vmn1r87 APN 7 13132361 utr 5 prime probably benign
PIT4142001:Vmn1r87 UTSW 7 13132185 missense probably benign 0.00
R0153:Vmn1r87 UTSW 7 13132284 missense probably damaging 1.00
R0502:Vmn1r87 UTSW 7 13131656 missense probably damaging 1.00
R0658:Vmn1r87 UTSW 7 13131829 missense probably damaging 1.00
R1589:Vmn1r87 UTSW 7 13131776 missense possibly damaging 0.46
R1731:Vmn1r87 UTSW 7 13131776 missense possibly damaging 0.46
R2027:Vmn1r87 UTSW 7 13131896 missense probably damaging 0.99
R2044:Vmn1r87 UTSW 7 13131821 missense probably benign 0.02
R3124:Vmn1r87 UTSW 7 13131566 missense probably damaging 1.00
R4208:Vmn1r87 UTSW 7 13132258 missense probably benign 0.37
R4731:Vmn1r87 UTSW 7 13132327 missense possibly damaging 0.92
R4732:Vmn1r87 UTSW 7 13132327 missense possibly damaging 0.92
R4733:Vmn1r87 UTSW 7 13132327 missense possibly damaging 0.92
R5079:Vmn1r87 UTSW 7 13132326 missense probably benign 0.01
R5125:Vmn1r87 UTSW 7 13131865 missense possibly damaging 0.79
R5178:Vmn1r87 UTSW 7 13131865 missense possibly damaging 0.79
R6599:Vmn1r87 UTSW 7 13131959 nonsense probably null
R7560:Vmn1r87 UTSW 7 13131818 missense probably damaging 1.00
X0028:Vmn1r87 UTSW 7 13131983 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- GAAACTGTGGACATGCCGTG -3'
(R):5'- ATACAGTGTTACTAGGGGCCTTTC -3'

Sequencing Primer
(F):5'- GGACATGCCGTGTACTCCTATTG -3'
(R):5'- AGTGTATTTCAAGCCATCACTCTCAG -3'
Posted On2019-05-13