Incidental Mutation 'R7067:Zc3h4'
ID548627
Institutional Source Beutler Lab
Gene Symbol Zc3h4
Ensembl Gene ENSMUSG00000059273
Gene Namezinc finger CCCH-type containing 4
SynonymsLOC330474, Kiaa1064-hp, Bwq1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7067 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location16400910-16437696 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 16429051 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 459 (K459*)
Ref Sequence ENSEMBL: ENSMUSP00000147665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098789] [ENSMUST00000209289]
Predicted Effect probably null
Transcript: ENSMUST00000098789
AA Change: K451*
SMART Domains Protein: ENSMUSP00000096386
Gene: ENSMUSG00000059273
AA Change: K451*

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 35 97 N/A INTRINSIC
low complexity region 144 170 N/A INTRINSIC
low complexity region 184 247 N/A INTRINSIC
low complexity region 264 324 N/A INTRINSIC
ZnF_C3H1 341 366 1.95e-3 SMART
ZnF_C3H1 370 395 6.17e-6 SMART
ZnF_C3H1 396 419 3.38e-1 SMART
low complexity region 433 451 N/A INTRINSIC
low complexity region 456 486 N/A INTRINSIC
low complexity region 489 505 N/A INTRINSIC
low complexity region 552 641 N/A INTRINSIC
low complexity region 705 720 N/A INTRINSIC
coiled coil region 729 760 N/A INTRINSIC
internal_repeat_2 767 822 3.38e-5 PROSPERO
low complexity region 837 850 N/A INTRINSIC
low complexity region 863 880 N/A INTRINSIC
low complexity region 881 892 N/A INTRINSIC
internal_repeat_2 986 1037 3.38e-5 PROSPERO
low complexity region 1049 1072 N/A INTRINSIC
low complexity region 1077 1097 N/A INTRINSIC
low complexity region 1175 1195 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000209289
AA Change: K459*
Meta Mutation Damage Score 0.554 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of CCCH (C-x8-C-x5-C-x3-H type) zinc finger domain-containing proteins. These zinc finger domains, which coordinate zinc finger binding and are characterized by three cysteine residues and one histidine residue, are nucleic acid-binding. Other family members are known to function in post-transcriptional regulation. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik T A 16: 91,056,033 S72C probably damaging Het
9330182L06Rik G T 5: 9,266,295 A9S possibly damaging Het
Abca13 A G 11: 9,291,845 D1236G probably benign Het
Abcc6 T C 7: 46,018,690 N165D probably benign Het
Aebp1 A G 11: 5,866,431 probably null Het
Anapc4 A G 5: 52,862,235 T580A probably benign Het
Apob T C 12: 8,009,423 I2602T probably damaging Het
Arap2 A G 5: 62,654,044 probably null Het
Asap3 T A 4: 136,241,362 probably null Het
Bend4 A G 5: 67,400,268 Y402H probably damaging Het
Crtc2 A G 3: 90,260,182 N271S probably benign Het
Csf2rb2 A T 15: 78,292,494 W233R probably damaging Het
Ctgf A G 10: 24,596,975 Y261C probably benign Het
Cyp2u1 G A 3: 131,293,553 L460F probably damaging Het
Dnm3 A G 1: 162,320,971 L277P probably damaging Het
Efemp1 A T 11: 28,867,926 N135I probably damaging Het
Fsip2 T A 2: 82,980,734 S2466T possibly damaging Het
Gal3st2 C T 1: 93,874,725 A276V possibly damaging Het
Gm47985 A T 1: 151,183,490 D294V unknown Het
Golga1 A T 2: 39,047,719 D104E probably benign Het
Hnrnpr C T 4: 136,327,393 A219V probably damaging Het
Hsd3b7 T C 7: 127,800,716 probably null Het
Hspa8 T C 9: 40,804,625 I562T probably damaging Het
Htra4 C T 8: 25,033,701 V283M probably damaging Het
Il1f5 C T 2: 24,277,529 R11* probably null Het
Iqcd A G 5: 120,605,147 T325A probably damaging Het
Kif23 A T 9: 61,924,989 M624K probably benign Het
Krt25 G T 11: 99,317,383 Q340K probably benign Het
Lamp3 T A 16: 19,699,663 N275Y probably damaging Het
Lpin2 A C 17: 71,244,858 K789T possibly damaging Het
Mroh2b T C 15: 4,900,504 I24T probably benign Het
Muc16 T A 9: 18,658,251 I991F unknown Het
Ntf5 T A 7: 45,415,624 L60Q probably damaging Het
Nuak1 A G 10: 84,440,294 S22P possibly damaging Het
Obox8 T C 7: 14,333,054 T22A possibly damaging Het
Olfr1053 T A 2: 86,314,567 T240S probably damaging Het
Pde8a T C 7: 81,317,326 V405A probably benign Het
Phc2 T C 4: 128,747,141 S147P probably benign Het
Pole G T 5: 110,334,218 G142V probably damaging Het
Poli G A 18: 70,509,417 Q508* probably null Het
Repin1 T A 6: 48,597,916 L537* probably null Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Samd7 G C 3: 30,751,123 K18N probably benign Het
Slc30a2 T A 4: 134,344,218 probably null Het
Slit3 A G 11: 35,508,230 S141G probably benign Het
Spata5 C T 3: 37,431,698 Q190* probably null Het
Spon2 A G 5: 33,214,614 S283P probably damaging Het
Srgap3 A T 6: 112,757,305 probably benign Het
Syde2 A G 3: 145,988,264 D89G probably benign Het
Syne1 A G 10: 5,234,586 I4099T probably damaging Het
Syt5 T C 7: 4,543,076 D105G probably benign Het
Tlx3 C T 11: 33,203,204 G86S probably damaging Het
Trim24 A T 6: 37,957,840 probably null Het
Umodl1 G A 17: 30,982,272 V392I probably damaging Het
Unc80 C A 1: 66,646,572 T2285K possibly damaging Het
Vars G A 17: 35,011,479 V513I probably damaging Het
Vmn1r87 T A 7: 13,131,922 Q146L probably benign Het
Vmn2r62 T C 7: 42,764,878 I714V probably benign Het
Xbp1 T A 11: 5,524,275 S159T probably damaging Het
Xrn1 T A 9: 95,969,512 H194Q probably damaging Het
Zdhhc6 G A 19: 55,304,439 R292* probably null Het
Zfp383 T A 7: 29,908,646 M1K probably null Het
Zfp703 A G 8: 26,979,016 D236G probably damaging Het
Other mutations in Zc3h4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Zc3h4 APN 7 16422234 missense unknown
IGL00923:Zc3h4 APN 7 16429692 missense unknown
IGL01541:Zc3h4 APN 7 16434332 missense unknown
IGL02115:Zc3h4 APN 7 16425783 missense unknown
IGL02303:Zc3h4 APN 7 16434077 missense unknown
IGL02336:Zc3h4 APN 7 16425777 missense unknown
IGL02734:Zc3h4 APN 7 16423924 missense unknown
IGL02736:Zc3h4 APN 7 16417383 nonsense probably null
R0032:Zc3h4 UTSW 7 16434640 missense unknown
R0032:Zc3h4 UTSW 7 16434640 missense unknown
R0220:Zc3h4 UTSW 7 16429273 missense unknown
R0336:Zc3h4 UTSW 7 16435178 missense unknown
R0416:Zc3h4 UTSW 7 16420275 missense probably damaging 1.00
R0666:Zc3h4 UTSW 7 16434772 missense unknown
R0864:Zc3h4 UTSW 7 16420179 missense probably damaging 0.99
R1068:Zc3h4 UTSW 7 16429236 missense unknown
R1145:Zc3h4 UTSW 7 16416913 missense possibly damaging 0.53
R1145:Zc3h4 UTSW 7 16416913 missense possibly damaging 0.53
R1472:Zc3h4 UTSW 7 16434770 missense unknown
R1665:Zc3h4 UTSW 7 16429580 missense unknown
R2087:Zc3h4 UTSW 7 16416940 missense possibly damaging 0.72
R2182:Zc3h4 UTSW 7 16422516 missense unknown
R2508:Zc3h4 UTSW 7 16434339 missense unknown
R3037:Zc3h4 UTSW 7 16421485 missense unknown
R4439:Zc3h4 UTSW 7 16429111 missense unknown
R4576:Zc3h4 UTSW 7 16434654 missense unknown
R5030:Zc3h4 UTSW 7 16422230 missense unknown
R5160:Zc3h4 UTSW 7 16434648 missense unknown
R5270:Zc3h4 UTSW 7 16434515 missense unknown
R5490:Zc3h4 UTSW 7 16429005 missense unknown
R5519:Zc3h4 UTSW 7 16435232 missense unknown
R5770:Zc3h4 UTSW 7 16429611 missense unknown
R7234:Zc3h4 UTSW 7 16429036 missense unknown
R7316:Zc3h4 UTSW 7 16435335 missense unknown
X0064:Zc3h4 UTSW 7 16422516 missense unknown
Predicted Primers PCR Primer
(F):5'- ATTGTGTACACTGTGCCCAGG -3'
(R):5'- ACAGTGGCTCATGTGTTGGC -3'

Sequencing Primer
(F):5'- CTGTGCCCAGGGTGATGAAG -3'
(R):5'- CTCATGTGTTGGCAGGGACATC -3'
Posted On2019-05-13