Mutagenetix > Incidental Mutation

Incidental Mutation 'R0613:Mrc1'

54863

Institutional Source

Beutler Lab

Gene Symbol

Mrc1

Ensembl Gene

ENSMUSG00000026712

Gene Name

mannose receptor, C type 1

Synonyms

CD206, MR

MMRRC Submission

038802-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.071) question?

Stock #

R0613 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

14234225-14336834 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 14299630 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 740 (A740V)

Ref Sequence

ENSEMBL: ENSMUSP00000028045 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028045]

AlphaFold

Q61830

PDB Structure

CRYSTAL STRUCTURE OF THE CYSTEINE RICH DOMAIN OF MANNOSE RECEPTOR [X-RAY DIFFRACTION]
Crystal structure of the cysteine rich domain of mannose receptor complexed with Acetylgalactosamine-4-sulfate [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MANNOSE RECEPTOR COMPLEXED WITH 3-SO4-LEWIS(X) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MANNOSE RECEPTOR COMPLEXED WITH 3-SO4-LEWIS(A) [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000028045
AA Change: A740V

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000028045
Gene: ENSMUSG00000026712
AA Change: A740V

Domain	Start	End	E-Value	Type
RICIN	22	142	8.09e-18	SMART
FN2	161	209	1.83e-27	SMART
CLECT	216	341	8.87e-26	SMART
CLECT	362	487	3.51e-38	SMART
CLECT	504	626	8.2e-30	SMART
CLECT	646	778	2.34e-34	SMART
CLECT	800	923	2.17e-29	SMART
low complexity region	935	941	N/A	INTRINSIC
CLECT	944	1079	3.35e-35	SMART
CLECT	1094	1212	4.11e-21	SMART
CLECT	1229	1355	3.63e-31	SMART
transmembrane domain	1388	1410	N/A	INTRINSIC

Meta Mutation Damage Score

0.1684

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.3%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The recognition of complex carbohydrate structures on glycoproteins is an important part of several biological processes, including cell-cell recognition, serum glycoprotein turnover, and neutralization of pathogens. The protein encoded by this gene is a type I membrane receptor that mediates the endocytosis of glycoproteins by macrophages. The protein has been shown to bind high-mannose structures on the surface of potentially pathogenic viruses, bacteria, and fungi so that they can be neutralized by phagocytic engulfment.[provided by RefSeq, Sep 2015]
PHENOTYPE: Male homozygotes for one targeted null mutation die in utero. Heterozygous females clear lutropin from the circulation more slowly and have smaller litters due to reduced implantation. Another targeted knockout is viable and homozygotes are less susceptible to parasitic infection. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acd	A	T	8: 106,427,200 (GRCm39)		probably null	Het
Adcy9	A	G	16: 4,237,403 (GRCm39)	S3P	probably damaging	Het
Adgrl4	T	C	3: 151,248,859 (GRCm39)		probably benign	Het
Aff3	T	C	1: 38,249,004 (GRCm39)	E700G	probably benign	Het
Ahctf1	A	G	1: 179,596,979 (GRCm39)	S56P	probably damaging	Het
Atp12a	T	A	14: 56,611,978 (GRCm39)	I384N	probably damaging	Het
Brca1	A	T	11: 101,399,036 (GRCm39)	S1519T	probably benign	Het
Ccl25	T	C	8: 4,399,850 (GRCm39)	V94A	probably benign	Het
Cep170	T	C	1: 176,602,246 (GRCm39)	T287A	probably benign	Het
Ces1a	A	G	8: 93,752,209 (GRCm39)	S383P	probably benign	Het
Cntnap3	A	T	13: 64,906,228 (GRCm39)	F793I	probably damaging	Het
Ctsm	T	C	13: 61,687,496 (GRCm39)	R89G	probably damaging	Het
Cyp2j12	T	G	4: 95,990,316 (GRCm39)	T417P	probably damaging	Het
D430041D05Rik	G	C	2: 103,998,295 (GRCm39)	P1836R	probably damaging	Het
Edn2	T	A	4: 120,019,061 (GRCm39)		probably null	Het
Emc1	T	A	4: 139,102,383 (GRCm39)		probably benign	Het
Entrep1	T	A	19: 23,963,853 (GRCm39)	N239Y	probably damaging	Het
Fras1	T	C	5: 96,848,347 (GRCm39)		probably benign	Het
Fsip2	A	T	2: 82,824,139 (GRCm39)	D6624V	probably damaging	Het
Gpr107	A	G	2: 31,068,297 (GRCm39)	Y253C	probably damaging	Het
Gpr108	A	G	17: 57,545,174 (GRCm39)		probably benign	Het
Grik1	A	G	16: 87,848,221 (GRCm39)		probably null	Het
Gtf3c1	G	A	7: 125,243,306 (GRCm39)	P1766L	possibly damaging	Het
Gucy2c	A	T	6: 136,737,721 (GRCm39)	N293K	probably damaging	Het
Hps6	C	A	19: 45,992,260 (GRCm39)	P66T	probably benign	Het
Hspa9	A	T	18: 35,081,033 (GRCm39)	V216E	probably damaging	Het
Igsf8	T	A	1: 172,145,156 (GRCm39)	M224K	probably benign	Het
Igsf9b	T	C	9: 27,238,216 (GRCm39)	V569A	probably damaging	Het
Itgb4	A	T	11: 115,884,168 (GRCm39)	I952F	probably damaging	Het
Kcnh4	C	T	11: 100,637,758 (GRCm39)	G633E	probably benign	Het
Khdrbs2	A	G	1: 32,696,603 (GRCm39)	H344R	possibly damaging	Het
Kmo	C	A	1: 175,465,458 (GRCm39)	R71S	probably damaging	Het
Lrrc31	A	G	3: 30,739,184 (GRCm39)		probably benign	Het
Map1b	T	A	13: 99,578,149 (GRCm39)	D168V	probably damaging	Het
Mfsd6	T	C	1: 52,697,855 (GRCm39)		probably benign	Het
Mgst1	G	A	6: 138,133,243 (GRCm39)	G186D	probably damaging	Het
Mroh2a	G	A	1: 88,171,672 (GRCm39)	R770Q	probably damaging	Het
Mtor	T	C	4: 148,610,503 (GRCm39)	Y1605H	possibly damaging	Het
Ncoa4	T	A	14: 31,898,509 (GRCm39)	L443Q	probably damaging	Het
Nelfa	G	A	5: 34,060,807 (GRCm39)		probably benign	Het
Nepn	T	A	10: 52,277,353 (GRCm39)	L363Q	probably damaging	Het
Nfat5	A	G	8: 108,092,927 (GRCm39)	T630A	possibly damaging	Het
Nipal4	A	T	11: 46,041,211 (GRCm39)	V328E	probably benign	Het
Or11h4b	T	A	14: 50,918,861 (GRCm39)	I77F	probably benign	Het
Or2y1e	T	A	11: 49,218,575 (GRCm39)	S112R	possibly damaging	Het
Or4c122	A	T	2: 89,079,469 (GRCm39)	C178S	probably damaging	Het
Or4d2b	A	T	11: 87,780,053 (GRCm39)	V223E	possibly damaging	Het
Or6c76	T	A	10: 129,612,131 (GRCm39)	M116K	probably damaging	Het
Or8d2	T	A	9: 38,759,909 (GRCm39)	C166*	probably null	Het
Otogl	A	T	10: 107,652,931 (GRCm39)	N1140K	probably damaging	Het
Ppip5k2	A	C	1: 97,680,465 (GRCm39)	Y236*	probably null	Het
Prelid1	C	T	13: 55,472,156 (GRCm39)	R111*	probably null	Het
Prpf8	T	C	11: 75,394,270 (GRCm39)	L1771P	probably damaging	Het
Ptprb	A	T	10: 116,138,230 (GRCm39)	Y378F	possibly damaging	Het
Ptprb	A	G	10: 116,138,283 (GRCm39)	T396A	possibly damaging	Het
Rab3il1	T	C	19: 10,005,728 (GRCm39)	L174P	probably damaging	Het
Rab4a	T	C	8: 124,550,574 (GRCm39)	V18A	possibly damaging	Het
Scn3a	T	A	2: 65,302,628 (GRCm39)	M1273L	possibly damaging	Het
Sdhc	A	T	1: 170,957,413 (GRCm39)	V156E	probably benign	Het
Slco3a1	T	C	7: 73,996,382 (GRCm39)		probably benign	Het
Syne3	T	C	12: 104,924,371 (GRCm39)	T343A	probably benign	Het
Syt11	A	G	3: 88,669,776 (GRCm39)	C39R	probably damaging	Het
Tll2	G	T	19: 41,093,429 (GRCm39)	D462E	probably damaging	Het
Tmem132e	T	A	11: 82,329,164 (GRCm39)	V481D	probably damaging	Het
Tmem161b	C	T	13: 84,399,439 (GRCm39)	L17F	probably damaging	Het
Vmn2r105	T	A	17: 20,428,578 (GRCm39)	I833F	probably damaging	Het
Vstm2a	A	T	11: 16,213,140 (GRCm39)	N175I	probably damaging	Het
Xpnpep1	G	T	19: 52,994,784 (GRCm39)	D238E	probably damaging	Het
Zfp112	G	A	7: 23,826,453 (GRCm39)	G807D	probably benign	Het
Zfp518b	A	T	5: 38,830,946 (GRCm39)	V353E	probably damaging	Het
Zfp69	T	C	4: 120,791,544 (GRCm39)	E39G	probably benign	Het
Zfp865	A	G	7: 5,032,090 (GRCm39)	H25R	possibly damaging	Het

Other mutations in Mrc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01013:Mrc1	APN	2	14,333,236 (GRCm39)	missense	probably damaging	1.00
IGL01326:Mrc1	APN	2	14,271,335 (GRCm39)	missense	probably damaging	1.00
IGL01340:Mrc1	APN	2	14,314,895 (GRCm39)	critical splice donor site	probably null
IGL01758:Mrc1	APN	2	14,243,059 (GRCm39)	missense	probably damaging	1.00
IGL01799:Mrc1	APN	2	14,243,187 (GRCm39)	missense	probably damaging	1.00
IGL02280:Mrc1	APN	2	14,249,024 (GRCm39)	missense	probably benign	0.19
IGL02435:Mrc1	APN	2	14,253,671 (GRCm39)	nonsense	probably null
IGL03073:Mrc1	APN	2	14,310,153 (GRCm39)	missense	probably damaging	1.00
IGL03110:Mrc1	APN	2	14,298,289 (GRCm39)	nonsense	probably null
IGL03155:Mrc1	APN	2	14,335,912 (GRCm39)	missense	probably benign	0.00
IGL03289:Mrc1	APN	2	14,313,634 (GRCm39)	critical splice donor site	probably null
amlodipine	UTSW	2	14,275,016 (GRCm39)	missense	probably damaging	1.00
losartan	UTSW	2	14,299,597 (GRCm39)	splice site	probably null
Shug	UTSW	2	14,275,017 (GRCm39)	missense	probably damaging	1.00
sussigkeit	UTSW	2	14,330,192 (GRCm39)	splice site	probably null
R0011:Mrc1	UTSW	2	14,266,148 (GRCm39)	critical splice donor site	probably null
R0011:Mrc1	UTSW	2	14,266,148 (GRCm39)	critical splice donor site	probably null
R0066:Mrc1	UTSW	2	14,266,011 (GRCm39)	missense	probably benign	0.42
R0066:Mrc1	UTSW	2	14,266,011 (GRCm39)	missense	probably benign	0.42
R0110:Mrc1	UTSW	2	14,243,353 (GRCm39)	splice site	probably benign
R0234:Mrc1	UTSW	2	14,284,705 (GRCm39)	missense	possibly damaging	0.65
R0234:Mrc1	UTSW	2	14,284,705 (GRCm39)	missense	possibly damaging	0.65
R0381:Mrc1	UTSW	2	14,312,720 (GRCm39)	missense	probably benign	0.05
R0505:Mrc1	UTSW	2	14,314,843 (GRCm39)	missense	probably damaging	1.00
R0539:Mrc1	UTSW	2	14,274,937 (GRCm39)	splice site	probably benign
R0626:Mrc1	UTSW	2	14,333,382 (GRCm39)	nonsense	probably null
R1122:Mrc1	UTSW	2	14,266,147 (GRCm39)	critical splice donor site	probably null
R1281:Mrc1	UTSW	2	14,298,321 (GRCm39)	missense	probably damaging	1.00
R1399:Mrc1	UTSW	2	14,284,736 (GRCm39)	missense	probably damaging	1.00
R1428:Mrc1	UTSW	2	14,320,074 (GRCm39)	missense	probably benign	0.11
R1571:Mrc1	UTSW	2	14,313,544 (GRCm39)	missense	probably damaging	0.97
R1596:Mrc1	UTSW	2	14,253,701 (GRCm39)	missense	possibly damaging	0.91
R1730:Mrc1	UTSW	2	14,332,655 (GRCm39)	missense	probably benign	0.01
R1733:Mrc1	UTSW	2	14,261,910 (GRCm39)	missense	probably damaging	1.00
R1783:Mrc1	UTSW	2	14,332,655 (GRCm39)	missense	probably benign	0.01
R1860:Mrc1	UTSW	2	14,333,390 (GRCm39)	missense	probably benign	0.30
R1872:Mrc1	UTSW	2	14,330,192 (GRCm39)	splice site	probably null
R1889:Mrc1	UTSW	2	14,313,488 (GRCm39)	critical splice acceptor site	probably null
R1938:Mrc1	UTSW	2	14,324,052 (GRCm39)	missense	possibly damaging	0.89
R1971:Mrc1	UTSW	2	14,249,103 (GRCm39)	critical splice donor site	probably null
R2031:Mrc1	UTSW	2	14,326,584 (GRCm39)	missense	probably damaging	1.00
R2136:Mrc1	UTSW	2	14,275,000 (GRCm39)	missense	probably damaging	1.00
R2152:Mrc1	UTSW	2	14,332,675 (GRCm39)	missense	probably damaging	1.00
R2168:Mrc1	UTSW	2	14,249,015 (GRCm39)	missense	possibly damaging	0.90
R2273:Mrc1	UTSW	2	14,330,183 (GRCm39)	missense	probably damaging	1.00
R2901:Mrc1	UTSW	2	14,333,354 (GRCm39)	missense	possibly damaging	0.94
R3767:Mrc1	UTSW	2	14,323,981 (GRCm39)	missense	probably damaging	1.00
R3795:Mrc1	UTSW	2	14,293,793 (GRCm39)	splice site	probably benign
R4028:Mrc1	UTSW	2	14,243,059 (GRCm39)	missense	probably damaging	1.00
R4668:Mrc1	UTSW	2	14,298,297 (GRCm39)	missense	probably damaging	1.00
R4828:Mrc1	UTSW	2	14,275,017 (GRCm39)	missense	probably damaging	1.00
R4897:Mrc1	UTSW	2	14,323,952 (GRCm39)	missense	probably benign	0.01
R4950:Mrc1	UTSW	2	14,276,091 (GRCm39)	missense	probably damaging	1.00
R5000:Mrc1	UTSW	2	14,249,000 (GRCm39)	missense	probably damaging	1.00
R5068:Mrc1	UTSW	2	14,311,327 (GRCm39)	missense	probably benign	0.00
R5279:Mrc1	UTSW	2	14,314,869 (GRCm39)	missense	probably damaging	0.99
R5366:Mrc1	UTSW	2	14,326,725 (GRCm39)	missense	probably benign	0.03
R5436:Mrc1	UTSW	2	14,271,326 (GRCm39)	missense	probably damaging	1.00
R5552:Mrc1	UTSW	2	14,284,768 (GRCm39)	missense	probably benign	0.05
R5631:Mrc1	UTSW	2	14,333,383 (GRCm39)	nonsense	probably null
R5831:Mrc1	UTSW	2	14,313,523 (GRCm39)	missense	probably damaging	0.99
R5978:Mrc1	UTSW	2	14,320,204 (GRCm39)	missense	probably damaging	0.97
R5993:Mrc1	UTSW	2	14,310,138 (GRCm39)	missense	probably damaging	1.00
R6030:Mrc1	UTSW	2	14,321,712 (GRCm39)	missense	probably benign	0.04
R6030:Mrc1	UTSW	2	14,321,712 (GRCm39)	missense	probably benign	0.04
R6038:Mrc1	UTSW	2	14,261,882 (GRCm39)	missense	probably damaging	1.00
R6038:Mrc1	UTSW	2	14,261,882 (GRCm39)	missense	probably damaging	1.00
R6228:Mrc1	UTSW	2	14,276,115 (GRCm39)	missense	probably benign	0.08
R6344:Mrc1	UTSW	2	14,248,985 (GRCm39)	missense	probably damaging	1.00
R6457:Mrc1	UTSW	2	14,275,016 (GRCm39)	missense	probably damaging	1.00
R6520:Mrc1	UTSW	2	14,312,760 (GRCm39)	missense	probably damaging	1.00
R6619:Mrc1	UTSW	2	14,299,597 (GRCm39)	splice site	probably null
R6631:Mrc1	UTSW	2	14,243,296 (GRCm39)	missense	probably benign
R6737:Mrc1	UTSW	2	14,276,088 (GRCm39)	missense	possibly damaging	0.95
R6782:Mrc1	UTSW	2	14,266,148 (GRCm39)	critical splice donor site	probably null
R6887:Mrc1	UTSW	2	14,330,048 (GRCm39)	missense	possibly damaging	0.94
R7108:Mrc1	UTSW	2	14,308,957 (GRCm39)	nonsense	probably null
R7120:Mrc1	UTSW	2	14,313,508 (GRCm39)	missense	probably damaging	0.97
R7460:Mrc1	UTSW	2	14,253,680 (GRCm39)	missense	probably damaging	1.00
R7567:Mrc1	UTSW	2	14,330,104 (GRCm39)	missense	probably damaging	1.00
R7606:Mrc1	UTSW	2	14,242,955 (GRCm39)	missense	probably damaging	1.00
R7725:Mrc1	UTSW	2	14,284,788 (GRCm39)	missense	probably benign	0.03
R7826:Mrc1	UTSW	2	14,299,668 (GRCm39)	missense	probably damaging	1.00
R8082:Mrc1	UTSW	2	14,253,771 (GRCm39)	missense	probably benign
R8279:Mrc1	UTSW	2	14,271,168 (GRCm39)	missense	possibly damaging	0.89
R8888:Mrc1	UTSW	2	14,312,760 (GRCm39)	missense	probably damaging	1.00
R8895:Mrc1	UTSW	2	14,312,760 (GRCm39)	missense	probably damaging	1.00
R8952:Mrc1	UTSW	2	14,253,735 (GRCm39)	missense	probably damaging	0.98
R9315:Mrc1	UTSW	2	14,248,969 (GRCm39)	nonsense	probably null
R9366:Mrc1	UTSW	2	14,321,709 (GRCm39)	missense	probably damaging	0.99
R9373:Mrc1	UTSW	2	14,274,999 (GRCm39)	missense	probably damaging	0.99
R9418:Mrc1	UTSW	2	14,234,358 (GRCm39)	missense	probably benign	0.12
R9420:Mrc1	UTSW	2	14,312,790 (GRCm39)	missense	possibly damaging	0.53
R9489:Mrc1	UTSW	2	14,324,110 (GRCm39)	missense	probably benign	0.06
R9564:Mrc1	UTSW	2	14,266,117 (GRCm39)	missense	probably benign	0.00
R9572:Mrc1	UTSW	2	14,234,334 (GRCm39)	missense	probably benign
R9605:Mrc1	UTSW	2	14,324,110 (GRCm39)	missense	probably benign	0.06
R9606:Mrc1	UTSW	2	14,313,517 (GRCm39)	missense	probably benign	0.01
R9781:Mrc1	UTSW	2	14,310,175 (GRCm39)	missense	possibly damaging	0.90
R9781:Mrc1	UTSW	2	14,249,100 (GRCm39)	missense	probably benign
Z1177:Mrc1	UTSW	2	14,293,927 (GRCm39)	missense	probably damaging	1.00
Z1177:Mrc1	UTSW	2	14,248,949 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATCCCATTGCTTGTGGCCCTG -3'
(R):5'- GGAACACTTATCTGTTTCCAACGTCCC -3'

Sequencing Primer
(F):5'- ACCCATGTCCATAAAATGTGCTTC -3'
(R):5'- CCATTCTTATCCTGTGAAATAAGGGC -3'

Posted On

2013-07-11