Incidental Mutation 'R7067:Xbp1'
ID548642
Institutional Source Beutler Lab
Gene Symbol Xbp1
Ensembl Gene ENSMUSG00000020484
Gene NameX-box binding protein 1
SynonymsXBP-1, D11Ertd39e, TREB-5, TREB5
MMRRC Submission
Accession Numbers

Genbank: NM_013842; MGI: 98970; Ensembl: ENSMUST00000109866

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7067 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location5520659-5525893 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 5524275 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 159 (S159T)
Ref Sequence ENSEMBL: ENSMUSP00000054852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020776] [ENSMUST00000063084] [ENSMUST00000149623]
Predicted Effect probably benign
Transcript: ENSMUST00000020776
SMART Domains Protein: ENSMUSP00000020776
Gene: ENSMUSG00000020482

DomainStartEndE-ValueType
low complexity region 22 37 N/A INTRINSIC
Pfam:CCDC117 139 277 1.9e-56 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000063084
AA Change: S159T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054852
Gene: ENSMUSG00000020484
AA Change: S159T

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
BRLZ 61 125 9.12e-18 SMART
low complexity region 185 198 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000134088
Gene: ENSMUSG00000020484
AA Change: S90T

DomainStartEndE-ValueType
BRLZ 2 57 2.62e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000149623
AA Change: S106T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135768
Gene: ENSMUSG00000020484
AA Change: S106T

DomainStartEndE-ValueType
BRLZ 11 72 3.68e-13 SMART
low complexity region 132 145 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that regulates MHC class II genes by binding to a promoter element referred to as an X box. This gene product is a bZIP protein, which was also identified as a cellular transcription factor that binds to an enhancer in the promoter of the T cell leukemia virus type 1 promoter. It may increase expression of viral proteins by acting as the DNA binding partner of a viral transactivator. It has been found that upon accumulation of unfolded proteins in the endoplasmic reticulum (ER), the mRNA of this gene is processed to an active form by an unconventional splicing mechanism that is mediated by the endonuclease inositol-requiring enzyme 1 (IRE1). The resulting loss of 26 nt from the spliced mRNA causes a frame-shift and an isoform XBP1(S), which is the functionally active transcription factor. The isoform encoded by the unspliced mRNA, XBP1(U), is constitutively expressed, and thought to function as a negative feedback regulator of XBP1(S), which shuts off transcription of target genes during the recovery phase of ER stress. A pseudogene of XBP1 has been identified and localized to chromosome 5. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit markedly impaired liver development resulting in severe anemia, necrosis of cardiac myocytes, morphological abnormalities of the neural tube, and fetal death around embryonic day 14. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted, knock-out(3) Targeted, other(6) Gene trapped(7)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik T A 16: 91,056,033 S72C probably damaging Het
9330182L06Rik G T 5: 9,266,295 A9S possibly damaging Het
Abca13 A G 11: 9,291,845 D1236G probably benign Het
Abcc6 T C 7: 46,018,690 N165D probably benign Het
Aebp1 A G 11: 5,866,431 probably null Het
Anapc4 A G 5: 52,862,235 T580A probably benign Het
Apob T C 12: 8,009,423 I2602T probably damaging Het
Arap2 A G 5: 62,654,044 probably null Het
Asap3 T A 4: 136,241,362 probably null Het
Bend4 A G 5: 67,400,268 Y402H probably damaging Het
Crtc2 A G 3: 90,260,182 N271S probably benign Het
Csf2rb2 A T 15: 78,292,494 W233R probably damaging Het
Ctgf A G 10: 24,596,975 Y261C probably benign Het
Cyp2u1 G A 3: 131,293,553 L460F probably damaging Het
Dnm3 A G 1: 162,320,971 L277P probably damaging Het
Efemp1 A T 11: 28,867,926 N135I probably damaging Het
Fsip2 T A 2: 82,980,734 S2466T possibly damaging Het
Gal3st2 C T 1: 93,874,725 A276V possibly damaging Het
Gm47985 A T 1: 151,183,490 D294V unknown Het
Golga1 A T 2: 39,047,719 D104E probably benign Het
Hnrnpr C T 4: 136,327,393 A219V probably damaging Het
Hsd3b7 T C 7: 127,800,716 probably null Het
Hspa8 T C 9: 40,804,625 I562T probably damaging Het
Htra4 C T 8: 25,033,701 V283M probably damaging Het
Il1f5 C T 2: 24,277,529 R11* probably null Het
Iqcd A G 5: 120,605,147 T325A probably damaging Het
Kif23 A T 9: 61,924,989 M624K probably benign Het
Krt25 G T 11: 99,317,383 Q340K probably benign Het
Lamp3 T A 16: 19,699,663 N275Y probably damaging Het
Lpin2 A C 17: 71,244,858 K789T possibly damaging Het
Mroh2b T C 15: 4,900,504 I24T probably benign Het
Muc16 T A 9: 18,658,251 I991F unknown Het
Ntf5 T A 7: 45,415,624 L60Q probably damaging Het
Nuak1 A G 10: 84,440,294 S22P possibly damaging Het
Obox8 T C 7: 14,333,054 T22A possibly damaging Het
Olfr1053 T A 2: 86,314,567 T240S probably damaging Het
Pde8a T C 7: 81,317,326 V405A probably benign Het
Phc2 T C 4: 128,747,141 S147P probably benign Het
Pole G T 5: 110,334,218 G142V probably damaging Het
Poli G A 18: 70,509,417 Q508* probably null Het
Repin1 T A 6: 48,597,916 L537* probably null Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Samd7 G C 3: 30,751,123 K18N probably benign Het
Slc30a2 T A 4: 134,344,218 probably null Het
Slit3 A G 11: 35,508,230 S141G probably benign Het
Spata5 C T 3: 37,431,698 Q190* probably null Het
Spon2 A G 5: 33,214,614 S283P probably damaging Het
Srgap3 A T 6: 112,757,305 probably benign Het
Syde2 A G 3: 145,988,264 D89G probably benign Het
Syne1 A G 10: 5,234,586 I4099T probably damaging Het
Syt5 T C 7: 4,543,076 D105G probably benign Het
Tlx3 C T 11: 33,203,204 G86S probably damaging Het
Trim24 A T 6: 37,957,840 probably null Het
Umodl1 G A 17: 30,982,272 V392I probably damaging Het
Unc80 C A 1: 66,646,572 T2285K possibly damaging Het
Vars G A 17: 35,011,479 V513I probably damaging Het
Vmn1r87 T A 7: 13,131,922 Q146L probably benign Het
Vmn2r62 T C 7: 42,764,878 I714V probably benign Het
Xrn1 T A 9: 95,969,512 H194Q probably damaging Het
Zc3h4 A T 7: 16,429,051 K459* probably null Het
Zdhhc6 G A 19: 55,304,439 R292* probably null Het
Zfp383 T A 7: 29,908,646 M1K probably null Het
Zfp703 A G 8: 26,979,016 D236G probably damaging Het
Other mutations in Xbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1601:Xbp1 UTSW 11 5521975 missense probably damaging 1.00
R2256:Xbp1 UTSW 11 5524841 missense probably damaging 1.00
R4647:Xbp1 UTSW 11 5522006 missense probably damaging 1.00
R4782:Xbp1 UTSW 11 5521167 missense probably damaging 1.00
R4964:Xbp1 UTSW 11 5521125 missense probably damaging 0.98
R5367:Xbp1 UTSW 11 5521910 missense probably benign
R5718:Xbp1 UTSW 11 5521903 missense probably benign 0.00
R5928:Xbp1 UTSW 11 5523514 intron probably benign
R6038:Xbp1 UTSW 11 5524798 missense probably benign 0.00
R6038:Xbp1 UTSW 11 5524798 missense probably benign 0.00
R6492:Xbp1 UTSW 11 5521005 missense probably benign
R6835:Xbp1 UTSW 11 5521809 start gained probably benign
R6955:Xbp1 UTSW 11 5522018 missense probably null 0.97
R7483:Xbp1 UTSW 11 5521098 missense probably benign 0.02
R7502:Xbp1 UTSW 11 5524683 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGGTTTATACACATCTCTGCTTAC -3'
(R):5'- TCTCCGTTTGCCTGGCTAAG -3'

Sequencing Primer
(F):5'- CAGCAGAGTGTCTCACTGAATCTG -3'
(R):5'- TGGCTAAGCGTGTCACAC -3'
Posted On2019-05-13