Mutagenetix > Incidental Mutations

Incidental Mutation 'R7067:Mroh2b'

548650

Institutional Source

Beutler Lab

Gene Symbol

Mroh2b

Ensembl Gene

ENSMUSG00000022155

Gene Name

maestro heat-like repeat family member 2B

Synonyms

4930455B06Rik, Heatr7b2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.100) question?

Stock #

R7067 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

4898737-4962205 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 4900504 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 24 (I24T)

Ref Sequence

ENSEMBL: ENSMUSP00000036148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045736]

Predicted Effect

probably benign
Transcript: ENSMUST00000045736
AA Change: I24T

PolyPhen 2 Score 0.349 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000036148
Gene: ENSMUSG00000022155
AA Change: I24T

Domain	Start	End	E-Value	Type
low complexity region	124	135	N/A	INTRINSIC
low complexity region	824	842	N/A	INTRINSIC
SCOP:d1gw5a_	937	1443	7e-15	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

98% (62/63)

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438H23Rik	T	A	16: 91,056,033	S72C	probably damaging	Het
9330182L06Rik	G	T	5: 9,266,295	A9S	possibly damaging	Het
Abca13	A	G	11: 9,291,845	D1236G	probably benign	Het
Abcc6	T	C	7: 46,018,690	N165D	probably benign	Het
Aebp1	A	G	11: 5,866,431		probably null	Het
Anapc4	A	G	5: 52,862,235	T580A	probably benign	Het
Apob	T	C	12: 8,009,423	I2602T	probably damaging	Het
Arap2	A	G	5: 62,654,044		probably null	Het
Asap3	T	A	4: 136,241,362		probably null	Het
Bend4	A	G	5: 67,400,268	Y402H	probably damaging	Het
Crtc2	A	G	3: 90,260,182	N271S	probably benign	Het
Csf2rb2	A	T	15: 78,292,494	W233R	probably damaging	Het
Ctgf	A	G	10: 24,596,975	Y261C	probably benign	Het
Cyp2u1	G	A	3: 131,293,553	L460F	probably damaging	Het
Dnm3	A	G	1: 162,320,971	L277P	probably damaging	Het
Efemp1	A	T	11: 28,867,926	N135I	probably damaging	Het
Fsip2	T	A	2: 82,980,734	S2466T	possibly damaging	Het
Gal3st2	C	T	1: 93,874,725	A276V	possibly damaging	Het
Gm47985	A	T	1: 151,183,490	D294V	unknown	Het
Golga1	A	T	2: 39,047,719	D104E	probably benign	Het
Hnrnpr	C	T	4: 136,327,393	A219V	probably damaging	Het
Hsd3b7	T	C	7: 127,800,716		probably null	Het
Hspa8	T	C	9: 40,804,625	I562T	probably damaging	Het
Htra4	C	T	8: 25,033,701	V283M	probably damaging	Het
Il1f5	C	T	2: 24,277,529	R11*	probably null	Het
Iqcd	A	G	5: 120,605,147	T325A	probably damaging	Het
Kif23	A	T	9: 61,924,989	M624K	probably benign	Het
Krt25	G	T	11: 99,317,383	Q340K	probably benign	Het
Lamp3	T	A	16: 19,699,663	N275Y	probably damaging	Het
Lpin2	A	C	17: 71,244,858	K789T	possibly damaging	Het
Muc16	T	A	9: 18,658,251	I991F	unknown	Het
Ntf5	T	A	7: 45,415,624	L60Q	probably damaging	Het
Nuak1	A	G	10: 84,440,294	S22P	possibly damaging	Het
Obox8	T	C	7: 14,333,054	T22A	possibly damaging	Het
Olfr1053	T	A	2: 86,314,567	T240S	probably damaging	Het
Pde8a	T	C	7: 81,317,326	V405A	probably benign	Het
Phc2	T	C	4: 128,747,141	S147P	probably benign	Het
Pole	G	T	5: 110,334,218	G142V	probably damaging	Het
Poli	G	A	18: 70,509,417	Q508*	probably null	Het
Repin1	T	A	6: 48,597,916	L537*	probably null	Het
Rictor	C	T	15: 6,772,154	S441L	probably benign	Het
Samd7	G	C	3: 30,751,123	K18N	probably benign	Het
Slc30a2	T	A	4: 134,344,218		probably null	Het
Slit3	A	G	11: 35,508,230	S141G	probably benign	Het
Spata5	C	T	3: 37,431,698	Q190*	probably null	Het
Spon2	A	G	5: 33,214,614	S283P	probably damaging	Het
Srgap3	A	T	6: 112,757,305		probably benign	Het
Syde2	A	G	3: 145,988,264	D89G	probably benign	Het
Syne1	A	G	10: 5,234,586	I4099T	probably damaging	Het
Syt5	T	C	7: 4,543,076	D105G	probably benign	Het
Tlx3	C	T	11: 33,203,204	G86S	probably damaging	Het
Trim24	A	T	6: 37,957,840		probably null	Het
Umodl1	G	A	17: 30,982,272	V392I	probably damaging	Het
Unc80	C	A	1: 66,646,572	T2285K	possibly damaging	Het
Vars	G	A	17: 35,011,479	V513I	probably damaging	Het
Vmn1r87	T	A	7: 13,131,922	Q146L	probably benign	Het
Vmn2r62	T	C	7: 42,764,878	I714V	probably benign	Het
Xbp1	T	A	11: 5,524,275	S159T	probably damaging	Het
Xrn1	T	A	9: 95,969,512	H194Q	probably damaging	Het
Zc3h4	A	T	7: 16,429,051	K459*	probably null	Het
Zdhhc6	G	A	19: 55,304,439	R292*	probably null	Het
Zfp383	T	A	7: 29,908,646	M1K	probably null	Het
Zfp703	A	G	8: 26,979,016	D236G	probably damaging	Het

Other mutations in Mroh2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00503:Mroh2b	APN	15	4899197	missense	probably benign
IGL00507:Mroh2b	APN	15	4962127	missense	probably damaging	1.00
IGL00548:Mroh2b	APN	15	4931316	missense	probably benign	0.35
IGL00902:Mroh2b	APN	15	4915222	missense	probably damaging	1.00
IGL00944:Mroh2b	APN	15	4951127	splice site	probably benign
IGL00954:Mroh2b	APN	15	4903054	missense	probably damaging	0.99
IGL01015:Mroh2b	APN	15	4941542	missense	probably damaging	1.00
IGL01134:Mroh2b	APN	15	4915152	missense	probably benign	0.00
IGL01337:Mroh2b	APN	15	4905024	missense	probably benign	0.38
IGL01780:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL01919:Mroh2b	APN	15	4923688	missense	probably benign	0.10
IGL02069:Mroh2b	APN	15	4904324	splice site	probably benign
IGL02146:Mroh2b	APN	15	4951294	splice site	probably null
IGL02221:Mroh2b	APN	15	4923641	missense	probably damaging	1.00
IGL02281:Mroh2b	APN	15	4952263	missense	probably benign	0.04
IGL02350:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL02357:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL02401:Mroh2b	APN	15	4900501	missense	possibly damaging	0.71
IGL02427:Mroh2b	APN	15	4951560	splice site	probably benign
IGL02432:Mroh2b	APN	15	4914186	missense	probably benign
IGL02582:Mroh2b	APN	15	4908515	missense	probably damaging	0.98
IGL02632:Mroh2b	APN	15	4931101	missense	probably damaging	0.99
IGL02741:Mroh2b	APN	15	4905632	missense	probably benign
IGL02811:Mroh2b	APN	15	4915236	missense	possibly damaging	0.55
IGL02826:Mroh2b	APN	15	4962148	missense	probably damaging	0.99
IGL03412:Mroh2b	APN	15	4944372	missense	probably benign	0.14
PIT4468001:Mroh2b	UTSW	15	4912812	missense	probably damaging	1.00
R0024:Mroh2b	UTSW	15	4925627	missense	probably damaging	1.00
R0333:Mroh2b	UTSW	15	4931118	missense	probably damaging	1.00
R0433:Mroh2b	UTSW	15	4941634	missense	probably benign	0.01
R0530:Mroh2b	UTSW	15	4934395	missense	probably damaging	0.97
R1411:Mroh2b	UTSW	15	4918317	missense	probably damaging	1.00
R1457:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1466:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1466:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1472:Mroh2b	UTSW	15	4948655	missense	probably benign	0.00
R1525:Mroh2b	UTSW	15	4951130	splice site	probably null
R1584:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1605:Mroh2b	UTSW	15	4945090	missense	probably benign	0.08
R1657:Mroh2b	UTSW	15	4931043	nonsense	probably null
R1671:Mroh2b	UTSW	15	4951294	splice site	probably null
R1698:Mroh2b	UTSW	15	4914140	missense	probably benign	0.02
R2002:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R2005:Mroh2b	UTSW	15	4917158	missense	probably damaging	1.00
R2077:Mroh2b	UTSW	15	4944966	missense	probably damaging	1.00
R2179:Mroh2b	UTSW	15	4921446	critical splice donor site	probably null
R2183:Mroh2b	UTSW	15	4918225	splice site	probably null
R3713:Mroh2b	UTSW	15	4943649	missense	probably benign	0.01
R3714:Mroh2b	UTSW	15	4943649	missense	probably benign	0.01
R3747:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3748:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3749:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3750:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3792:Mroh2b	UTSW	15	4923620	missense	probably damaging	1.00
R3872:Mroh2b	UTSW	15	4925061	nonsense	probably null
R4021:Mroh2b	UTSW	15	4925100	missense	possibly damaging	0.75
R4329:Mroh2b	UTSW	15	4931379	missense	probably damaging	0.99
R4456:Mroh2b	UTSW	15	4947925	missense	probably benign	0.21
R4592:Mroh2b	UTSW	15	4918290	missense	probably damaging	1.00
R4836:Mroh2b	UTSW	15	4904270	missense	probably damaging	1.00
R5050:Mroh2b	UTSW	15	4900450	missense	possibly damaging	0.82
R5230:Mroh2b	UTSW	15	4941522	missense	probably benign	0.07
R5342:Mroh2b	UTSW	15	4914133	nonsense	probably null
R5353:Mroh2b	UTSW	15	4917178	missense	probably damaging	1.00
R5368:Mroh2b	UTSW	15	4905572	missense	probably damaging	1.00
R5424:Mroh2b	UTSW	15	4941612	missense	probably damaging	0.98
R5484:Mroh2b	UTSW	15	4908981	missense	possibly damaging	0.92
R5999:Mroh2b	UTSW	15	4912884	splice site	probably null
R6046:Mroh2b	UTSW	15	4951281	missense	probably benign	0.01
R6081:Mroh2b	UTSW	15	4944377	missense	probably damaging	1.00
R6162:Mroh2b	UTSW	15	4915225	missense	probably damaging	1.00
R6165:Mroh2b	UTSW	15	4918350	missense	probably benign	0.23
R6240:Mroh2b	UTSW	15	4934644	missense	probably benign	0.38
R6487:Mroh2b	UTSW	15	4947239	missense	probably damaging	1.00
R6539:Mroh2b	UTSW	15	4905574	missense	probably damaging	1.00
R6616:Mroh2b	UTSW	15	4953282	missense	probably benign	0.36
R6663:Mroh2b	UTSW	15	4947935	missense	probably benign	0.21
R6820:Mroh2b	UTSW	15	4953274	missense	probably damaging	1.00
R6900:Mroh2b	UTSW	15	4908987	missense	probably benign	0.00
R6990:Mroh2b	UTSW	15	4912802	missense	possibly damaging	0.55
R7092:Mroh2b	UTSW	15	4934678	missense	possibly damaging	0.92
R7102:Mroh2b	UTSW	15	4948003	missense	probably benign	0.06
R7264:Mroh2b	UTSW	15	4921362	missense	possibly damaging	0.81
R7436:Mroh2b	UTSW	15	4941554	missense	probably benign	0.21
R7462:Mroh2b	UTSW	15	4908627	missense	probably damaging	1.00
R7529:Mroh2b	UTSW	15	4949009	missense	probably damaging	1.00
R7575:Mroh2b	UTSW	15	4934605	missense	probably damaging	1.00
R7579:Mroh2b	UTSW	15	4931061	missense	probably benign	0.09
R7605:Mroh2b	UTSW	15	4945023	missense	probably damaging	1.00
R7624:Mroh2b	UTSW	15	4917131	missense	probably damaging	1.00
R7797:Mroh2b	UTSW	15	4949105	missense	probably benign	0.36
R7848:Mroh2b	UTSW	15	4938379	nonsense	probably null
R7952:Mroh2b	UTSW	15	4951211	missense	probably damaging	1.00
R7995:Mroh2b	UTSW	15	4921357	nonsense	probably null
R8088:Mroh2b	UTSW	15	4900503	missense	possibly damaging	0.57
R8207:Mroh2b	UTSW	15	4938410	missense	possibly damaging	0.95
R8242:Mroh2b	UTSW	15	4909040	missense	probably benign	0.04
R8248:Mroh2b	UTSW	15	4931104	missense	probably benign	0.40
R8258:Mroh2b	UTSW	15	4911909	missense	probably benign	0.01
R8259:Mroh2b	UTSW	15	4911909	missense	probably benign	0.01
R8304:Mroh2b	UTSW	15	4925637	missense	probably damaging	0.99
R8316:Mroh2b	UTSW	15	4951264	nonsense	probably null
R8345:Mroh2b	UTSW	15	4944326	missense	probably benign	0.09
R8507:Mroh2b	UTSW	15	4949090	missense	probably damaging	1.00
X0067:Mroh2b	UTSW	15	4951591	missense	possibly damaging	0.90
Z1177:Mroh2b	UTSW	15	4905005	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAAGTCCTGTAGGGATAGGAAA -3'
(R):5'- TTTAGTGACATAAGAGAAGCCAGG -3'

Sequencing Primer
(F):5'- AAGTCCTGTAGGGATAGGAAATATAG -3'
(R):5'- TGACATAAGAGAAGCCAGGAAAAGTG -3'

Posted On

2019-05-13