Incidental Mutation 'R7067:Umodl1'
ID 548655
Institutional Source Beutler Lab
Gene Symbol Umodl1
Ensembl Gene ENSMUSG00000054134
Gene Name uromodulin-like 1
Synonyms D17Ertd488e
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7067 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 30954679-31010708 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 30982272 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 392 (V392I)
Ref Sequence ENSEMBL: ENSMUSP00000065470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066554] [ENSMUST00000066981] [ENSMUST00000114555]
AlphaFold Q5DID3
Predicted Effect possibly damaging
Transcript: ENSMUST00000066554
AA Change: V392I

PolyPhen 2 Score 0.619 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134
AA Change: V392I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000066981
AA Change: V392I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134
AA Change: V392I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 8.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 8.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 619 632 N/A INTRINSIC
SEA 706 821 8.88e-2 SMART
EGF 818 859 4.26e0 SMART
ZP 909 1152 5.44e-25 SMART
transmembrane domain 1186 1208 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114555
AA Change: V392I

PolyPhen 2 Score 0.619 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134
AA Change: V392I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 9.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 9.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik T A 16: 91,056,033 S72C probably damaging Het
9330182L06Rik G T 5: 9,266,295 A9S possibly damaging Het
Abca13 A G 11: 9,291,845 D1236G probably benign Het
Abcc6 T C 7: 46,018,690 N165D probably benign Het
Aebp1 A G 11: 5,866,431 probably null Het
Anapc4 A G 5: 52,862,235 T580A probably benign Het
Apob T C 12: 8,009,423 I2602T probably damaging Het
Arap2 A G 5: 62,654,044 probably null Het
Asap3 T A 4: 136,241,362 probably null Het
Bend4 A G 5: 67,400,268 Y402H probably damaging Het
Crtc2 A G 3: 90,260,182 N271S probably benign Het
Csf2rb2 A T 15: 78,292,494 W233R probably damaging Het
Ctgf A G 10: 24,596,975 Y261C probably benign Het
Cyp2u1 G A 3: 131,293,553 L460F probably damaging Het
Dnm3 A G 1: 162,320,971 L277P probably damaging Het
Efemp1 A T 11: 28,867,926 N135I probably damaging Het
Fsip2 T A 2: 82,980,734 S2466T possibly damaging Het
Gal3st2 C T 1: 93,874,725 A276V possibly damaging Het
Gm47985 A T 1: 151,183,490 D294V unknown Het
Golga1 A T 2: 39,047,719 D104E probably benign Het
Hnrnpr C T 4: 136,327,393 A219V probably damaging Het
Hsd3b7 T C 7: 127,800,716 probably null Het
Hspa8 T C 9: 40,804,625 I562T probably damaging Het
Htra4 C T 8: 25,033,701 V283M probably damaging Het
Il1f5 C T 2: 24,277,529 R11* probably null Het
Iqcd A G 5: 120,605,147 T325A probably damaging Het
Kif23 A T 9: 61,924,989 M624K probably benign Het
Krt25 G T 11: 99,317,383 Q340K probably benign Het
Lamp3 T A 16: 19,699,663 N275Y probably damaging Het
Lpin2 A C 17: 71,244,858 K789T possibly damaging Het
Mroh2b T C 15: 4,900,504 I24T probably benign Het
Muc16 T A 9: 18,658,251 I991F unknown Het
Ntf5 T A 7: 45,415,624 L60Q probably damaging Het
Nuak1 A G 10: 84,440,294 S22P possibly damaging Het
Obox8 T C 7: 14,333,054 T22A possibly damaging Het
Olfr1053 T A 2: 86,314,567 T240S probably damaging Het
Pde8a T C 7: 81,317,326 V405A probably benign Het
Phc2 T C 4: 128,747,141 S147P probably benign Het
Pole G T 5: 110,334,218 G142V probably damaging Het
Poli G A 18: 70,509,417 Q508* probably null Het
Repin1 T A 6: 48,597,916 L537* probably null Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Samd7 G C 3: 30,751,123 K18N probably benign Het
Slc30a2 T A 4: 134,344,218 probably null Het
Slit3 A G 11: 35,508,230 S141G probably benign Het
Spata5 C T 3: 37,431,698 Q190* probably null Het
Spon2 A G 5: 33,214,614 S283P probably damaging Het
Srgap3 A T 6: 112,757,305 probably benign Het
Syde2 A G 3: 145,988,264 D89G probably benign Het
Syne1 A G 10: 5,234,586 I4099T probably damaging Het
Syt5 T C 7: 4,543,076 D105G probably benign Het
Tlx3 C T 11: 33,203,204 G86S probably damaging Het
Trim24 A T 6: 37,957,840 probably null Het
Unc80 C A 1: 66,646,572 T2285K possibly damaging Het
Vars G A 17: 35,011,479 V513I probably damaging Het
Vmn1r87 T A 7: 13,131,922 Q146L probably benign Het
Vmn2r62 T C 7: 42,764,878 I714V probably benign Het
Xbp1 T A 11: 5,524,275 S159T probably damaging Het
Xrn1 T A 9: 95,969,512 H194Q probably damaging Het
Zc3h4 A T 7: 16,429,051 K459* probably null Het
Zdhhc6 G A 19: 55,304,439 R292* probably null Het
Zfp383 T A 7: 29,908,646 M1K probably null Het
Zfp703 A G 8: 26,979,016 D236G probably damaging Het
Other mutations in Umodl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Umodl1 APN 17 31008750 utr 3 prime probably benign
IGL01344:Umodl1 APN 17 30996264 missense probably damaging 0.99
IGL01529:Umodl1 APN 17 30996259 missense possibly damaging 0.94
IGL01609:Umodl1 APN 17 30998826 missense possibly damaging 0.90
IGL01625:Umodl1 APN 17 30996255 missense probably benign 0.00
IGL01877:Umodl1 APN 17 30982320 missense probably benign 0.00
IGL01977:Umodl1 APN 17 30973768 missense probably damaging 0.99
IGL02063:Umodl1 APN 17 30987914 missense probably benign 0.07
IGL02160:Umodl1 APN 17 30986117 missense probably damaging 0.97
IGL02252:Umodl1 APN 17 30994815 critical splice donor site probably null
IGL02427:Umodl1 APN 17 30968441 splice site probably benign
IGL02496:Umodl1 APN 17 30998654 missense probably damaging 0.99
IGL02633:Umodl1 APN 17 30989488 missense probably damaging 1.00
IGL03271:Umodl1 APN 17 30986499 nonsense probably null
IGL03392:Umodl1 APN 17 30996355 missense probably damaging 0.98
Disquieting UTSW 17 30959155 missense probably damaging 1.00
floored UTSW 17 30988057 nonsense probably null
R7231_umodl1_507 UTSW 17 30986116 missense probably damaging 1.00
surprising UTSW 17 30986465 missense possibly damaging 0.77
unsettling UTSW 17 30986554 nonsense probably null
G1citation:Umodl1 UTSW 17 30986554 nonsense probably null
PIT4468001:Umodl1 UTSW 17 30959278 missense probably damaging 1.00
R0048:Umodl1 UTSW 17 30968477 missense probably damaging 1.00
R0048:Umodl1 UTSW 17 30968477 missense probably damaging 1.00
R0653:Umodl1 UTSW 17 30984028 missense probably benign 0.00
R0831:Umodl1 UTSW 17 30996351 missense probably damaging 1.00
R1078:Umodl1 UTSW 17 30959373 missense probably benign 0.00
R1166:Umodl1 UTSW 17 31002798 splice site probably benign
R1231:Umodl1 UTSW 17 30959278 missense probably damaging 1.00
R1459:Umodl1 UTSW 17 30982258 splice site probably benign
R1459:Umodl1 UTSW 17 30986504 missense probably benign 0.05
R1510:Umodl1 UTSW 17 30959229 missense probably damaging 1.00
R1654:Umodl1 UTSW 17 30987968 missense probably benign
R1757:Umodl1 UTSW 17 31008700 missense probably damaging 0.99
R1781:Umodl1 UTSW 17 30968550 missense probably damaging 1.00
R1873:Umodl1 UTSW 17 30982264 missense probably damaging 0.99
R1911:Umodl1 UTSW 17 30992154 missense possibly damaging 0.74
R1917:Umodl1 UTSW 17 30984043 missense probably damaging 1.00
R1918:Umodl1 UTSW 17 30984043 missense probably damaging 1.00
R2057:Umodl1 UTSW 17 31008766 critical splice donor site probably null
R2058:Umodl1 UTSW 17 31008766 critical splice donor site probably null
R2089:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2091:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2091:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2431:Umodl1 UTSW 17 30992088 missense possibly damaging 0.79
R2903:Umodl1 UTSW 17 30992173 missense probably damaging 1.00
R3032:Umodl1 UTSW 17 30989528 missense probably benign 0.01
R3956:Umodl1 UTSW 17 31002863 missense probably benign 0.10
R3975:Umodl1 UTSW 17 30984789 nonsense probably null
R4207:Umodl1 UTSW 17 30959367 missense probably damaging 1.00
R4287:Umodl1 UTSW 17 30988065 missense probably benign 0.11
R4452:Umodl1 UTSW 17 30994815 critical splice donor site probably null
R4684:Umodl1 UTSW 17 30998114 missense probably benign 0.00
R4769:Umodl1 UTSW 17 30984002 missense possibly damaging 0.92
R4887:Umodl1 UTSW 17 31008665 missense probably benign 0.06
R4888:Umodl1 UTSW 17 30999201 missense probably damaging 1.00
R4978:Umodl1 UTSW 17 30986081 missense probably benign
R4993:Umodl1 UTSW 17 30986485 missense probably benign 0.00
R5241:Umodl1 UTSW 17 30984092 missense probably benign 0.18
R5254:Umodl1 UTSW 17 30980359 missense possibly damaging 0.86
R5454:Umodl1 UTSW 17 30986465 missense possibly damaging 0.77
R5456:Umodl1 UTSW 17 30982289 missense probably benign 0.04
R5754:Umodl1 UTSW 17 30994787 missense probably damaging 0.96
R6189:Umodl1 UTSW 17 30996282 missense possibly damaging 0.75
R6222:Umodl1 UTSW 17 31002892 critical splice donor site probably null
R6289:Umodl1 UTSW 17 30982351 missense probably benign 0.16
R6432:Umodl1 UTSW 17 30986147 missense probably benign 0.38
R6478:Umodl1 UTSW 17 30959155 missense probably damaging 1.00
R6702:Umodl1 UTSW 17 30986299 splice site probably null
R6822:Umodl1 UTSW 17 30986554 nonsense probably null
R6999:Umodl1 UTSW 17 30999123 missense probably damaging 1.00
R7123:Umodl1 UTSW 17 30982344 missense possibly damaging 0.90
R7219:Umodl1 UTSW 17 30982262 critical splice acceptor site probably null
R7231:Umodl1 UTSW 17 30986116 missense probably damaging 1.00
R7234:Umodl1 UTSW 17 30986621 missense possibly damaging 0.87
R7297:Umodl1 UTSW 17 31008665 missense probably benign 0.06
R7392:Umodl1 UTSW 17 30982332 missense probably damaging 0.99
R7401:Umodl1 UTSW 17 30998148 missense probably damaging 1.00
R7461:Umodl1 UTSW 17 30988057 nonsense probably null
R7594:Umodl1 UTSW 17 30954805 missense probably benign 0.02
R7613:Umodl1 UTSW 17 30988057 nonsense probably null
R7763:Umodl1 UTSW 17 30986456 missense probably benign 0.24
R7797:Umodl1 UTSW 17 30959151 missense probably benign 0.02
R7832:Umodl1 UTSW 17 30973692 critical splice acceptor site probably null
R7954:Umodl1 UTSW 17 30986387 missense probably benign 0.00
R8088:Umodl1 UTSW 17 30973796 missense probably benign 0.29
R8111:Umodl1 UTSW 17 30971818 missense probably damaging 0.99
R8314:Umodl1 UTSW 17 30984832 missense probably damaging 0.99
R8826:Umodl1 UTSW 17 30983984 missense possibly damaging 0.65
R9067:Umodl1 UTSW 17 30973703 missense probably damaging 1.00
R9091:Umodl1 UTSW 17 30966704 missense probably damaging 1.00
R9099:Umodl1 UTSW 17 30959173 missense probably benign 0.01
R9270:Umodl1 UTSW 17 30966704 missense probably damaging 1.00
R9341:Umodl1 UTSW 17 30998727 missense possibly damaging 0.95
R9343:Umodl1 UTSW 17 30998727 missense possibly damaging 0.95
R9400:Umodl1 UTSW 17 30996393 missense probably damaging 0.99
R9569:Umodl1 UTSW 17 30998169 missense probably damaging 1.00
R9615:Umodl1 UTSW 17 30998178 missense possibly damaging 0.94
R9787:Umodl1 UTSW 17 30959350 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGTGTCAGTGTTACCATTCC -3'
(R):5'- TTTGCCCAACCACAAGGAGG -3'

Sequencing Primer
(F):5'- GTCAGTGTTACCATTCCTTGTATAG -3'
(R):5'- GGAGCCAGATTGATGATATACACTTG -3'
Posted On 2019-05-13