Incidental Mutation 'R7068:Tdrd5'
ID548662
Institutional Source Beutler Lab
Gene Symbol Tdrd5
Ensembl Gene ENSMUSG00000060985
Gene Nametudor domain containing 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.261) question?
Stock #R7068 (G1)
Quality Score208.009
Status Not validated
Chromosome1
Chromosomal Location156255296-156303664 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 156284271 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 436 (E436G)
Ref Sequence ENSEMBL: ENSMUSP00000137182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121146] [ENSMUST00000167528]
Predicted Effect probably damaging
Transcript: ENSMUST00000121146
AA Change: E513G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137298
Gene: ENSMUSG00000060985
AA Change: E513G

DomainStartEndE-ValueType
Pfam:OST-HTH 6 76 3.7e-11 PFAM
Pfam:OST-HTH 126 194 1.5e-10 PFAM
Pfam:OST-HTH 290 361 7.4e-10 PFAM
TUDOR 532 590 3.25e-7 SMART
low complexity region 739 753 N/A INTRINSIC
low complexity region 1001 1021 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167528
AA Change: E436G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137182
Gene: ENSMUSG00000060985
AA Change: E436G

DomainStartEndE-ValueType
Pfam:OST-HTH 6 75 1.4e-9 PFAM
Pfam:OST-HTH 213 284 6.4e-9 PFAM
TUDOR 455 513 3.25e-7 SMART
low complexity region 662 676 N/A INTRINSIC
low complexity region 924 944 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility associated with defective spermatid elongation, occasional arrested male meiosis, and apoptosis of male germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 A G 7: 119,622,580 H24R probably benign Het
Ago2 A T 15: 73,146,450 F46L probably damaging Het
Amd1 A G 10: 40,290,512 F123L probably benign Het
Arhgef10 T C 8: 14,958,639 F546L probably damaging Het
Asic2 G A 11: 81,152,255 H71Y probably benign Het
Asphd1 A G 7: 126,948,678 V151A probably benign Het
Best3 T C 10: 116,988,638 V3A probably damaging Het
C4b A G 17: 34,733,477 L1196P probably damaging Het
Cd22 A G 7: 30,878,079 V3A probably benign Het
Cdkl3 T C 11: 52,011,327 probably null Het
Clcnka A T 4: 141,387,110 V631E probably damaging Het
Cmya5 A G 13: 93,092,697 V1961A possibly damaging Het
Dnah14 A G 1: 181,769,790 E3559G probably benign Het
Emsy A T 7: 98,610,761 D39E probably benign Het
Fam126a A G 5: 23,964,795 S519P possibly damaging Het
Fbxl16 G T 17: 25,819,511 V477F possibly damaging Het
Flt1 A T 5: 147,673,634 I393N probably damaging Het
Gabra4 A T 5: 71,572,059 N433K probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Ghsr T A 3: 27,371,837 V14D probably benign Het
Glb1l A G 1: 75,202,737 Y183H probably damaging Het
Ighv3-4 T C 12: 114,253,654 T106A probably damaging Het
Ik T G 18: 36,755,465 F439V possibly damaging Het
Itih5 T C 2: 10,249,304 S789P probably damaging Het
Kcnj8 T C 6: 142,566,239 D214G probably damaging Het
Kdm5a C A 6: 120,430,215 H1464N probably benign Het
Klb A T 5: 65,379,340 Y671F probably damaging Het
Kremen2 C A 17: 23,741,885 R421L possibly damaging Het
Mroh9 T A 1: 163,039,181 D662V probably damaging Het
Mtmr12 T G 15: 12,257,670 M278R probably null Het
Ndufa8 T C 2: 36,044,435 M44V possibly damaging Het
Nedd4l A T 18: 65,205,651 R695S probably damaging Het
Nuf2 G A 1: 169,522,419 P97S probably damaging Het
Olfr1018 T C 2: 85,823,052 V27A probably benign Het
Olfr206 T C 16: 59,345,204 T166A possibly damaging Het
Olfr310 A C 7: 86,269,537 L84R probably damaging Het
P4ha2 A G 11: 54,110,994 T33A probably benign Het
Parp1 A G 1: 180,588,668 H544R probably damaging Het
Plec A G 15: 76,177,769 L2678P probably damaging Het
Rad1 T A 15: 10,490,293 Y85* probably null Het
Sema6d A G 2: 124,657,821 I309V probably benign Het
Skint2 T C 4: 112,624,351 V137A probably damaging Het
Slc23a3 T C 1: 75,133,233 N130S probably benign Het
Slc35f1 T C 10: 53,062,500 F176S probably damaging Het
Slc44a2 T A 9: 21,320,848 Y10N probably benign Het
Smarcc1 A G 9: 110,185,884 T506A probably damaging Het
Smchd1 A T 17: 71,387,092 S1219R probably benign Het
Smco1 A G 16: 32,274,111 N200S probably benign Het
Srcap A G 7: 127,541,943 T1571A probably benign Het
Strip2 C T 6: 29,932,208 T459I probably benign Het
Tarbp1 C T 8: 126,427,034 A1560T probably damaging Het
Tcl1b1 T A 12: 105,159,693 probably benign Het
Trim31 T A 17: 36,898,516 C55S probably damaging Het
Tsr1 G T 11: 74,903,919 E467* probably null Het
Tulp4 T A 17: 6,185,289 D178E probably damaging Het
Vmn1r30 A G 6: 58,435,010 V279A possibly damaging Het
Vmn2r98 A G 17: 19,065,313 R132G probably benign Het
Other mutations in Tdrd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01651:Tdrd5 APN 1 156301827 missense probably benign 0.32
IGL02441:Tdrd5 APN 1 156259943 splice site probably benign
IGL02932:Tdrd5 APN 1 156270620 missense possibly damaging 0.52
R0049:Tdrd5 UTSW 1 156301903 missense probably damaging 1.00
R0416:Tdrd5 UTSW 1 156285481 missense probably damaging 0.96
R0518:Tdrd5 UTSW 1 156262941 missense probably damaging 0.99
R1439:Tdrd5 UTSW 1 156277487 missense probably damaging 1.00
R1454:Tdrd5 UTSW 1 156259836 missense probably benign 0.41
R1497:Tdrd5 UTSW 1 156255802 missense probably benign 0.28
R1774:Tdrd5 UTSW 1 156277509 missense probably damaging 1.00
R2101:Tdrd5 UTSW 1 156301639 missense probably damaging 1.00
R2125:Tdrd5 UTSW 1 156276573 missense probably damaging 0.99
R2126:Tdrd5 UTSW 1 156276573 missense probably damaging 0.99
R2197:Tdrd5 UTSW 1 156259865 missense probably benign 0.02
R3820:Tdrd5 UTSW 1 156285483 missense probably benign 0.16
R3928:Tdrd5 UTSW 1 156300778 missense probably benign 0.06
R4258:Tdrd5 UTSW 1 156259742 missense probably benign 0.00
R4502:Tdrd5 UTSW 1 156300764 missense probably benign 0.00
R4601:Tdrd5 UTSW 1 156284374 missense probably benign 0.12
R4602:Tdrd5 UTSW 1 156284374 missense probably benign 0.12
R4610:Tdrd5 UTSW 1 156284374 missense probably benign 0.12
R4611:Tdrd5 UTSW 1 156284374 missense probably benign 0.12
R4674:Tdrd5 UTSW 1 156277435 missense probably damaging 1.00
R4722:Tdrd5 UTSW 1 156302375 missense probably benign 0.31
R4778:Tdrd5 UTSW 1 156255587 missense probably damaging 0.98
R5737:Tdrd5 UTSW 1 156300724 missense probably benign 0.01
R5881:Tdrd5 UTSW 1 156294500 missense probably damaging 0.98
R5900:Tdrd5 UTSW 1 156277435 nonsense probably null
R6234:Tdrd5 UTSW 1 156293377 missense possibly damaging 0.93
R6557:Tdrd5 UTSW 1 156300721 missense probably benign 0.10
R7184:Tdrd5 UTSW 1 156259935 missense probably benign 0.30
R7199:Tdrd5 UTSW 1 156301723 missense probably damaging 0.98
R7432:Tdrd5 UTSW 1 156302432 missense probably damaging 1.00
R7469:Tdrd5 UTSW 1 156262905 missense probably benign 0.00
X0026:Tdrd5 UTSW 1 156285427 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGACTATTGCACATGCTTGG -3'
(R):5'- TGAATCTGCCTTGAGCCCAG -3'

Sequencing Primer
(F):5'- GACTATTGCACATGCTTGGATTAG -3'
(R):5'- ACTGCAATAAGGCTGATTCGTG -3'
Posted On2019-05-13