Incidental Mutation 'R7068:Nuf2'
ID548664
Institutional Source Beutler Lab
Gene Symbol Nuf2
Ensembl Gene ENSMUSG00000026683
Gene NameNUF2, NDC80 kinetochore complex component
SynonymsNuf2R, Cdca1, 2410003C07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R7068 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location169497934-169531464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 169522419 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 97 (P97S)
Ref Sequence ENSEMBL: ENSMUSP00000141427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028000] [ENSMUST00000111368] [ENSMUST00000192248]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028000
AA Change: P97S

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000028000
Gene: ENSMUSG00000026683
AA Change: P97S

DomainStartEndE-ValueType
Pfam:Nuf2 1 149 9.7e-46 PFAM
coiled coil region 174 227 N/A INTRINSIC
coiled coil region 290 343 N/A INTRINSIC
coiled coil region 389 462 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111368
AA Change: P97S

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000106999
Gene: ENSMUSG00000026683
AA Change: P97S

DomainStartEndE-ValueType
Pfam:Nuf2 3 146 6.5e-37 PFAM
coiled coil region 174 227 N/A INTRINSIC
coiled coil region 290 343 N/A INTRINSIC
coiled coil region 389 462 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192248
AA Change: P97S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141427
Gene: ENSMUSG00000026683
AA Change: P97S

DomainStartEndE-ValueType
Pfam:Nuf2 1 149 2.3e-43 PFAM
SCOP:d1ab4__ 154 210 9e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195342
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is highly similar to yeast Nuf2, a component of a conserved protein complex associated with the centromere. Yeast Nuf2 disappears from the centromere during meiotic prophase when centromeres lose their connection to the spindle pole body, and plays a regulatory role in chromosome segregation. The encoded protein is found to be associated with centromeres of mitotic HeLa cells, which suggests that this protein is a functional homolog of yeast Nuf2. Alternatively spliced transcript variants that encode the same protein have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 A G 7: 119,622,580 H24R probably benign Het
Ago2 A T 15: 73,146,450 F46L probably damaging Het
Amd1 A G 10: 40,290,512 F123L probably benign Het
Arhgef10 T C 8: 14,958,639 F546L probably damaging Het
Asic2 G A 11: 81,152,255 H71Y probably benign Het
Asphd1 A G 7: 126,948,678 V151A probably benign Het
Best3 T C 10: 116,988,638 V3A probably damaging Het
C4b A G 17: 34,733,477 L1196P probably damaging Het
Cd22 A G 7: 30,878,079 V3A probably benign Het
Cdkl3 T C 11: 52,011,327 probably null Het
Clcnka A T 4: 141,387,110 V631E probably damaging Het
Cmya5 A G 13: 93,092,697 V1961A possibly damaging Het
Dnah14 A G 1: 181,769,790 E3559G probably benign Het
Emsy A T 7: 98,610,761 D39E probably benign Het
Fam126a A G 5: 23,964,795 S519P possibly damaging Het
Fbxl16 G T 17: 25,819,511 V477F possibly damaging Het
Flt1 A T 5: 147,673,634 I393N probably damaging Het
Gabra4 A T 5: 71,572,059 N433K probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Ghsr T A 3: 27,371,837 V14D probably benign Het
Glb1l A G 1: 75,202,737 Y183H probably damaging Het
Ighv3-4 T C 12: 114,253,654 T106A probably damaging Het
Ik T G 18: 36,755,465 F439V possibly damaging Het
Itih5 T C 2: 10,249,304 S789P probably damaging Het
Kcnj8 T C 6: 142,566,239 D214G probably damaging Het
Kdm5a C A 6: 120,430,215 H1464N probably benign Het
Klb A T 5: 65,379,340 Y671F probably damaging Het
Kremen2 C A 17: 23,741,885 R421L possibly damaging Het
Mroh9 T A 1: 163,039,181 D662V probably damaging Het
Mtmr12 T G 15: 12,257,670 M278R probably null Het
Ndufa8 T C 2: 36,044,435 M44V possibly damaging Het
Nedd4l A T 18: 65,205,651 R695S probably damaging Het
Olfr1018 T C 2: 85,823,052 V27A probably benign Het
Olfr206 T C 16: 59,345,204 T166A possibly damaging Het
Olfr310 A C 7: 86,269,537 L84R probably damaging Het
P4ha2 A G 11: 54,110,994 T33A probably benign Het
Parp1 A G 1: 180,588,668 H544R probably damaging Het
Plec A G 15: 76,177,769 L2678P probably damaging Het
Rad1 T A 15: 10,490,293 Y85* probably null Het
Sema6d A G 2: 124,657,821 I309V probably benign Het
Skint2 T C 4: 112,624,351 V137A probably damaging Het
Slc23a3 T C 1: 75,133,233 N130S probably benign Het
Slc35f1 T C 10: 53,062,500 F176S probably damaging Het
Slc44a2 T A 9: 21,320,848 Y10N probably benign Het
Smarcc1 A G 9: 110,185,884 T506A probably damaging Het
Smchd1 A T 17: 71,387,092 S1219R probably benign Het
Smco1 A G 16: 32,274,111 N200S probably benign Het
Srcap A G 7: 127,541,943 T1571A probably benign Het
Strip2 C T 6: 29,932,208 T459I probably benign Het
Tarbp1 C T 8: 126,427,034 A1560T probably damaging Het
Tcl1b1 T A 12: 105,159,693 probably benign Het
Tdrd5 T C 1: 156,284,271 E436G probably damaging Het
Trim31 T A 17: 36,898,516 C55S probably damaging Het
Tsr1 G T 11: 74,903,919 E467* probably null Het
Tulp4 T A 17: 6,185,289 D178E probably damaging Het
Vmn1r30 A G 6: 58,435,010 V279A possibly damaging Het
Vmn2r98 A G 17: 19,065,313 R132G probably benign Het
Other mutations in Nuf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00707:Nuf2 APN 1 169522435 unclassified probably benign
IGL00980:Nuf2 APN 1 169510434 missense probably damaging 1.00
IGL01131:Nuf2 APN 1 169522364 splice site probably benign
IGL01310:Nuf2 APN 1 169498862 missense probably benign 0.12
IGL01774:Nuf2 APN 1 169506072 missense probably benign
IGL01786:Nuf2 APN 1 169510483 missense possibly damaging 0.88
IGL01866:Nuf2 APN 1 169498838 missense possibly damaging 0.68
IGL02134:Nuf2 APN 1 169513500 missense probably benign
IGL02955:Nuf2 APN 1 169507238 splice site probably benign
R0350:Nuf2 UTSW 1 169513543 critical splice acceptor site probably null
R0390:Nuf2 UTSW 1 169525297 unclassified probably benign
R0479:Nuf2 UTSW 1 169498934 splice site probably benign
R0578:Nuf2 UTSW 1 169510549 splice site probably benign
R0765:Nuf2 UTSW 1 169522936 unclassified probably benign
R1351:Nuf2 UTSW 1 169510549 splice site probably benign
R1564:Nuf2 UTSW 1 169498793 missense unknown
R3747:Nuf2 UTSW 1 169525376 missense probably damaging 1.00
R3748:Nuf2 UTSW 1 169525376 missense probably damaging 1.00
R3749:Nuf2 UTSW 1 169525376 missense probably damaging 1.00
R4601:Nuf2 UTSW 1 169506114 missense probably damaging 1.00
R4815:Nuf2 UTSW 1 169510468 missense probably damaging 1.00
R5473:Nuf2 UTSW 1 169507287 missense probably benign 0.05
R5522:Nuf2 UTSW 1 169498884 missense probably damaging 1.00
R5716:Nuf2 UTSW 1 169522389 missense probably benign 0.23
R5742:Nuf2 UTSW 1 169516622 missense probably damaging 1.00
R6583:Nuf2 UTSW 1 169504548 missense probably benign
R6680:Nuf2 UTSW 1 169515009 splice site probably null
R7099:Nuf2 UTSW 1 169506072 missense probably benign
R7186:Nuf2 UTSW 1 169525385 missense probably damaging 0.99
R7527:Nuf2 UTSW 1 169498853 missense possibly damaging 0.55
R7578:Nuf2 UTSW 1 169504528 missense probably benign 0.00
R7836:Nuf2 UTSW 1 169525329 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCACACTTCATAGGGCAACATC -3'
(R):5'- TGCACTGTAGAAGCACTATGC -3'

Sequencing Primer
(F):5'- TTCATAGGGCAACATCAACCCAGAG -3'
(R):5'- CTATGCACTATAGTAGCACTAAGCAC -3'
Posted On2019-05-13