Incidental Mutation 'R7068:Dnah14'
ID548666
Institutional Source Beutler Lab
Gene Symbol Dnah14
Ensembl Gene ENSMUSG00000047369
Gene Namedynein, axonemal, heavy chain 14
SynonymsDnahc14, Gm980, LOC381311, A230079K17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R7068 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location181576559-181815774 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 181769790 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 3559 (E3559G)
Ref Sequence ENSEMBL: ENSMUSP00000146843 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000208001
AA Change: E3559G

PolyPhen 2 Score 0.346 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. Two major classes of dyneins, axonemal and cytoplasmic, have been identified. DNAH14 is an axonemal dynein heavy chain (DHC) (Vaughan et al., 1996 [PubMed 8812413]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 A G 7: 119,622,580 H24R probably benign Het
Ago2 A T 15: 73,146,450 F46L probably damaging Het
Amd1 A G 10: 40,290,512 F123L probably benign Het
Arhgef10 T C 8: 14,958,639 F546L probably damaging Het
Asic2 G A 11: 81,152,255 H71Y probably benign Het
Asphd1 A G 7: 126,948,678 V151A probably benign Het
Best3 T C 10: 116,988,638 V3A probably damaging Het
C4b A G 17: 34,733,477 L1196P probably damaging Het
Cd22 A G 7: 30,878,079 V3A probably benign Het
Cdkl3 T C 11: 52,011,327 probably null Het
Clcnka A T 4: 141,387,110 V631E probably damaging Het
Cmya5 A G 13: 93,092,697 V1961A possibly damaging Het
Emsy A T 7: 98,610,761 D39E probably benign Het
Fam126a A G 5: 23,964,795 S519P possibly damaging Het
Fbxl16 G T 17: 25,819,511 V477F possibly damaging Het
Flt1 A T 5: 147,673,634 I393N probably damaging Het
Gabra4 A T 5: 71,572,059 N433K probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Ghsr T A 3: 27,371,837 V14D probably benign Het
Glb1l A G 1: 75,202,737 Y183H probably damaging Het
Ighv3-4 T C 12: 114,253,654 T106A probably damaging Het
Ik T G 18: 36,755,465 F439V possibly damaging Het
Itih5 T C 2: 10,249,304 S789P probably damaging Het
Kcnj8 T C 6: 142,566,239 D214G probably damaging Het
Kdm5a C A 6: 120,430,215 H1464N probably benign Het
Klb A T 5: 65,379,340 Y671F probably damaging Het
Kremen2 C A 17: 23,741,885 R421L possibly damaging Het
Mroh9 T A 1: 163,039,181 D662V probably damaging Het
Mtmr12 T G 15: 12,257,670 M278R probably null Het
Ndufa8 T C 2: 36,044,435 M44V possibly damaging Het
Nedd4l A T 18: 65,205,651 R695S probably damaging Het
Nuf2 G A 1: 169,522,419 P97S probably damaging Het
Olfr1018 T C 2: 85,823,052 V27A probably benign Het
Olfr206 T C 16: 59,345,204 T166A possibly damaging Het
Olfr310 A C 7: 86,269,537 L84R probably damaging Het
P4ha2 A G 11: 54,110,994 T33A probably benign Het
Parp1 A G 1: 180,588,668 H544R probably damaging Het
Plec A G 15: 76,177,769 L2678P probably damaging Het
Rad1 T A 15: 10,490,293 Y85* probably null Het
Sema6d A G 2: 124,657,821 I309V probably benign Het
Skint2 T C 4: 112,624,351 V137A probably damaging Het
Slc23a3 T C 1: 75,133,233 N130S probably benign Het
Slc35f1 T C 10: 53,062,500 F176S probably damaging Het
Slc44a2 T A 9: 21,320,848 Y10N probably benign Het
Smarcc1 A G 9: 110,185,884 T506A probably damaging Het
Smchd1 A T 17: 71,387,092 S1219R probably benign Het
Smco1 A G 16: 32,274,111 N200S probably benign Het
Srcap A G 7: 127,541,943 T1571A probably benign Het
Strip2 C T 6: 29,932,208 T459I probably benign Het
Tarbp1 C T 8: 126,427,034 A1560T probably damaging Het
Tcl1b1 T A 12: 105,159,693 probably benign Het
Tdrd5 T C 1: 156,284,271 E436G probably damaging Het
Trim31 T A 17: 36,898,516 C55S probably damaging Het
Tsr1 G T 11: 74,903,919 E467* probably null Het
Tulp4 T A 17: 6,185,289 D178E probably damaging Het
Vmn1r30 A G 6: 58,435,010 V279A possibly damaging Het
Vmn2r98 A G 17: 19,065,313 R132G probably benign Het
Other mutations in Dnah14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Dnah14 APN 1 181752046 missense probably benign 0.17
IGL01764:Dnah14 APN 1 181744777 missense probably benign 0.00
IGL03218:Dnah14 APN 1 181755269 missense probably benign 0.02
IGL03290:Dnah14 APN 1 181763978 splice site probably benign
IGL03384:Dnah14 APN 1 181745949 missense probably benign 0.03
R0009:Dnah14 UTSW 1 181769407 splice site probably benign
R0125:Dnah14 UTSW 1 181752063 missense probably damaging 0.99
R0579:Dnah14 UTSW 1 181744747 missense possibly damaging 0.72
R0973:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R0973:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R0974:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R1609:Dnah14 UTSW 1 181750177 missense probably damaging 0.97
R1860:Dnah14 UTSW 1 181763960 missense probably damaging 1.00
R2050:Dnah14 UTSW 1 181752562 missense probably damaging 1.00
R2974:Dnah14 UTSW 1 181755241 critical splice acceptor site probably null
R4715:Dnah14 UTSW 1 181757223 missense probably damaging 1.00
R5076:Dnah14 UTSW 1 181757234 missense probably benign 0.01
R5424:Dnah14 UTSW 1 181763310 missense possibly damaging 0.95
R5808:Dnah14 UTSW 1 181741159 missense possibly damaging 0.72
R5997:Dnah14 UTSW 1 181770105 missense probably benign 0.00
R6052:Dnah14 UTSW 1 181666487 missense possibly damaging 0.50
R6061:Dnah14 UTSW 1 181709051 missense probably damaging 1.00
R6089:Dnah14 UTSW 1 181750154 missense probably damaging 1.00
R6092:Dnah14 UTSW 1 181621833 missense probably benign 0.13
R6145:Dnah14 UTSW 1 181666417 missense probably benign 0.00
R6163:Dnah14 UTSW 1 181666361 missense probably benign 0.33
R6246:Dnah14 UTSW 1 181680888 missense probably benign 0.00
R6302:Dnah14 UTSW 1 181601206 missense possibly damaging 0.96
R6306:Dnah14 UTSW 1 181585024 frame shift probably null
R6326:Dnah14 UTSW 1 181783556 missense probably damaging 1.00
R6348:Dnah14 UTSW 1 181626720 missense possibly damaging 0.83
R6367:Dnah14 UTSW 1 181755386 splice site probably null
R6376:Dnah14 UTSW 1 181605894 missense possibly damaging 0.79
R6389:Dnah14 UTSW 1 181651202 critical splice donor site probably null
R6433:Dnah14 UTSW 1 181651657 missense probably damaging 0.99
R6454:Dnah14 UTSW 1 181783705 missense probably damaging 1.00
R6476:Dnah14 UTSW 1 181744768 missense probably benign 0.26
R6523:Dnah14 UTSW 1 181643621 missense probably benign 0.00
R6529:Dnah14 UTSW 1 181666469 missense probably damaging 0.98
R6538:Dnah14 UTSW 1 181584985 missense unknown
R6546:Dnah14 UTSW 1 181738987 missense probably damaging 1.00
R6752:Dnah14 UTSW 1 181593452 missense probably benign 0.07
R6762:Dnah14 UTSW 1 181757259 missense probably damaging 1.00
R6786:Dnah14 UTSW 1 181641405 missense probably benign 0.21
R6849:Dnah14 UTSW 1 181808945 missense probably benign 0.00
R6877:Dnah14 UTSW 1 181628432 missense possibly damaging 0.82
R6912:Dnah14 UTSW 1 181750183 missense possibly damaging 0.83
R6919:Dnah14 UTSW 1 181585066 missense probably benign 0.04
R6924:Dnah14 UTSW 1 181627952 missense probably benign 0.04
R6957:Dnah14 UTSW 1 181785175 missense possibly damaging 0.92
R6980:Dnah14 UTSW 1 181648230 missense probably benign 0.00
R7018:Dnah14 UTSW 1 181626944 missense possibly damaging 0.55
R7046:Dnah14 UTSW 1 181623003 missense probably benign 0.01
R7058:Dnah14 UTSW 1 181698049 missense probably benign 0.00
R7115:Dnah14 UTSW 1 181720145 missense probably damaging 1.00
R7130:Dnah14 UTSW 1 181745958 nonsense probably null
R7165:Dnah14 UTSW 1 181704535 missense probably benign 0.00
R7169:Dnah14 UTSW 1 181702365 missense probably benign 0.00
R7184:Dnah14 UTSW 1 181704529 nonsense probably null
R7232:Dnah14 UTSW 1 181757363 missense probably damaging 1.00
R7260:Dnah14 UTSW 1 181706744 missense probably damaging 0.99
R7276:Dnah14 UTSW 1 181685807 missense probably benign 0.41
R7290:Dnah14 UTSW 1 181628174 missense probably benign 0.20
R7314:Dnah14 UTSW 1 181785254 splice site probably null
R7326:Dnah14 UTSW 1 181598403 missense probably benign 0.02
R7336:Dnah14 UTSW 1 181797734 missense probably damaging 0.96
R7363:Dnah14 UTSW 1 181690524 splice site probably null
R7371:Dnah14 UTSW 1 181626885 missense probably benign 0.05
R7376:Dnah14 UTSW 1 181763402 missense probably benign 0.03
R7418:Dnah14 UTSW 1 181616742 missense possibly damaging 0.92
R7473:Dnah14 UTSW 1 181752139 missense probably damaging 0.99
R7514:Dnah14 UTSW 1 181628067 missense probably damaging 0.96
R7555:Dnah14 UTSW 1 181770054 missense probably benign 0.26
R7641:Dnah14 UTSW 1 181707533 missense probably benign 0.01
R7663:Dnah14 UTSW 1 181752155 splice site probably null
R7674:Dnah14 UTSW 1 181707533 missense probably benign 0.01
R7680:Dnah14 UTSW 1 181685800 missense probably benign 0.15
R7709:Dnah14 UTSW 1 181702484 critical splice donor site probably null
R7842:Dnah14 UTSW 1 181627898 missense probably damaging 0.99
R7861:Dnah14 UTSW 1 181616759 missense probably damaging 1.00
R7988:Dnah14 UTSW 1 181783574 missense probably damaging 0.97
R8016:Dnah14 UTSW 1 181648311 missense probably benign 0.05
R8042:Dnah14 UTSW 1 181643631 critical splice donor site probably null
R8071:Dnah14 UTSW 1 181615894 missense possibly damaging 0.84
R8086:Dnah14 UTSW 1 181766232 missense probably damaging 1.00
R8095:Dnah14 UTSW 1 181806032 nonsense probably null
R8139:Dnah14 UTSW 1 181755288 missense probably damaging 1.00
R8176:Dnah14 UTSW 1 181657033 missense probably damaging 0.96
R8193:Dnah14 UTSW 1 181688205 missense probably damaging 1.00
R8197:Dnah14 UTSW 1 181690101 missense possibly damaging 0.94
R8209:Dnah14 UTSW 1 181795545 missense possibly damaging 0.69
R8226:Dnah14 UTSW 1 181795545 missense possibly damaging 0.69
R8251:Dnah14 UTSW 1 181664865 missense probably damaging 1.00
R8264:Dnah14 UTSW 1 181744792 missense probably damaging 0.99
R8284:Dnah14 UTSW 1 181773811 missense probably benign 0.03
R8289:Dnah14 UTSW 1 181716215 nonsense probably null
R8323:Dnah14 UTSW 1 181704544 missense probably benign 0.01
R8442:Dnah14 UTSW 1 181741284 missense probably damaging 0.97
R8458:Dnah14 UTSW 1 181806012 missense
R8507:Dnah14 UTSW 1 181641414 missense probably benign 0.02
R8509:Dnah14 UTSW 1 181814655 missense
RF007:Dnah14 UTSW 1 181685809 missense probably benign 0.00
RF012:Dnah14 UTSW 1 181627898 missense probably damaging 0.99
Z1176:Dnah14 UTSW 1 181757351 missense possibly damaging 0.83
Z1177:Dnah14 UTSW 1 181690320 missense probably benign 0.03
Z1177:Dnah14 UTSW 1 181763334 missense probably damaging 1.00
Z1177:Dnah14 UTSW 1 181766304 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAGATGTACCAGTTCTCCCTG -3'
(R):5'- CTGCCATCAGAGTGTCACTG -3'

Sequencing Primer
(F):5'- AGTTCTCCCTGGAGTGGCTC -3'
(R):5'- GCCATCAGAGTGTCACTGGAATTC -3'
Posted On2019-05-13