Incidental Mutation 'R7068:Itih5'
ID548667
Institutional Source Beutler Lab
Gene Symbol Itih5
Ensembl Gene ENSMUSG00000025780
Gene Nameinter-alpha (globulin) inhibitor H5
Synonyms5430408M01Rik, 4631408O11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R7068 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location10153571-10256529 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10249304 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 789 (S789P)
Ref Sequence ENSEMBL: ENSMUSP00000026886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026886]
Predicted Effect probably damaging
Transcript: ENSMUST00000026886
AA Change: S789P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000026886
Gene: ENSMUSG00000025780
AA Change: S789P

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 30 45 N/A INTRINSIC
Pfam:VIT 51 159 5.5e-27 PFAM
VWA 293 476 5.84e-24 SMART
Pfam:ITI_HC_C 716 909 1.7e-60 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heavy chain component of one of the inter-alpha-trypsin inhibitor (ITI) family members. ITI proteins are involved in extracellular matrix stabilization and in the prevention of tumor metastasis. They are also structurally related plasma serine protease inhibitors and are composed of a light chain and varying numbers of heavy chains. This family member is thought to function as a tumor suppressor in breast and thyroid cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 A G 7: 119,622,580 H24R probably benign Het
Ago2 A T 15: 73,146,450 F46L probably damaging Het
Amd1 A G 10: 40,290,512 F123L probably benign Het
Arhgef10 T C 8: 14,958,639 F546L probably damaging Het
Asic2 G A 11: 81,152,255 H71Y probably benign Het
Asphd1 A G 7: 126,948,678 V151A probably benign Het
Best3 T C 10: 116,988,638 V3A probably damaging Het
C4b A G 17: 34,733,477 L1196P probably damaging Het
Cd22 A G 7: 30,878,079 V3A probably benign Het
Cdkl3 T C 11: 52,011,327 probably null Het
Clcnka A T 4: 141,387,110 V631E probably damaging Het
Cmya5 A G 13: 93,092,697 V1961A possibly damaging Het
Dnah14 A G 1: 181,769,790 E3559G probably benign Het
Emsy A T 7: 98,610,761 D39E probably benign Het
Fam126a A G 5: 23,964,795 S519P possibly damaging Het
Fbxl16 G T 17: 25,819,511 V477F possibly damaging Het
Flt1 A T 5: 147,673,634 I393N probably damaging Het
Gabra4 A T 5: 71,572,059 N433K probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Ghsr T A 3: 27,371,837 V14D probably benign Het
Glb1l A G 1: 75,202,737 Y183H probably damaging Het
Ighv3-4 T C 12: 114,253,654 T106A probably damaging Het
Ik T G 18: 36,755,465 F439V possibly damaging Het
Kcnj8 T C 6: 142,566,239 D214G probably damaging Het
Kdm5a C A 6: 120,430,215 H1464N probably benign Het
Klb A T 5: 65,379,340 Y671F probably damaging Het
Kremen2 C A 17: 23,741,885 R421L possibly damaging Het
Mroh9 T A 1: 163,039,181 D662V probably damaging Het
Mtmr12 T G 15: 12,257,670 M278R probably null Het
Ndufa8 T C 2: 36,044,435 M44V possibly damaging Het
Nedd4l A T 18: 65,205,651 R695S probably damaging Het
Nuf2 G A 1: 169,522,419 P97S probably damaging Het
Olfr1018 T C 2: 85,823,052 V27A probably benign Het
Olfr206 T C 16: 59,345,204 T166A possibly damaging Het
Olfr310 A C 7: 86,269,537 L84R probably damaging Het
P4ha2 A G 11: 54,110,994 T33A probably benign Het
Parp1 A G 1: 180,588,668 H544R probably damaging Het
Plec A G 15: 76,177,769 L2678P probably damaging Het
Rad1 T A 15: 10,490,293 Y85* probably null Het
Sema6d A G 2: 124,657,821 I309V probably benign Het
Skint2 T C 4: 112,624,351 V137A probably damaging Het
Slc23a3 T C 1: 75,133,233 N130S probably benign Het
Slc35f1 T C 10: 53,062,500 F176S probably damaging Het
Slc44a2 T A 9: 21,320,848 Y10N probably benign Het
Smarcc1 A G 9: 110,185,884 T506A probably damaging Het
Smchd1 A T 17: 71,387,092 S1219R probably benign Het
Smco1 A G 16: 32,274,111 N200S probably benign Het
Srcap A G 7: 127,541,943 T1571A probably benign Het
Strip2 C T 6: 29,932,208 T459I probably benign Het
Tarbp1 C T 8: 126,427,034 A1560T probably damaging Het
Tcl1b1 T A 12: 105,159,693 probably benign Het
Tdrd5 T C 1: 156,284,271 E436G probably damaging Het
Trim31 T A 17: 36,898,516 C55S probably damaging Het
Tsr1 G T 11: 74,903,919 E467* probably null Het
Tulp4 T A 17: 6,185,289 D178E probably damaging Het
Vmn1r30 A G 6: 58,435,010 V279A possibly damaging Het
Vmn2r98 A G 17: 19,065,313 R132G probably benign Het
Other mutations in Itih5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Itih5 APN 2 10190289 missense probably damaging 1.00
IGL02125:Itih5 APN 2 10240987 missense probably benign
IGL02370:Itih5 APN 2 10186975 missense probably benign 0.05
IGL03376:Itih5 APN 2 10206773 missense probably benign 0.12
IGL02991:Itih5 UTSW 2 10251351 missense probably benign 0.01
R0090:Itih5 UTSW 2 10164684 missense probably benign 0.03
R0096:Itih5 UTSW 2 10251378 missense probably benign 0.02
R0096:Itih5 UTSW 2 10251378 missense probably benign 0.02
R0158:Itih5 UTSW 2 10234992 splice site probably benign
R0270:Itih5 UTSW 2 10251264 missense probably benign 0.38
R0276:Itih5 UTSW 2 10185564 missense possibly damaging 0.80
R0807:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0810:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0903:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0905:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0906:Itih5 UTSW 2 10249188 missense probably benign 0.00
R1104:Itih5 UTSW 2 10251512 missense probably benign 0.03
R1397:Itih5 UTSW 2 10240807 missense probably benign 0.14
R1671:Itih5 UTSW 2 10186971 missense probably benign 0.03
R1971:Itih5 UTSW 2 10238568 missense probably damaging 1.00
R3684:Itih5 UTSW 2 10238624 missense possibly damaging 0.93
R3685:Itih5 UTSW 2 10238624 missense possibly damaging 0.93
R3831:Itih5 UTSW 2 10251270 missense possibly damaging 0.95
R3934:Itih5 UTSW 2 10245544 missense probably damaging 0.98
R4670:Itih5 UTSW 2 10190369 missense probably benign 0.01
R4803:Itih5 UTSW 2 10240581 missense probably benign
R4950:Itih5 UTSW 2 10235081 missense probably damaging 0.98
R5020:Itih5 UTSW 2 10240504 splice site probably null
R5735:Itih5 UTSW 2 10240761 missense probably benign 0.00
R6454:Itih5 UTSW 2 10240668 missense probably benign
R6662:Itih5 UTSW 2 10249181 missense probably benign 0.13
R7019:Itih5 UTSW 2 10190327 missense probably damaging 1.00
R7246:Itih5 UTSW 2 10187062 splice site probably null
R7424:Itih5 UTSW 2 10245637 missense probably damaging 1.00
R7452:Itih5 UTSW 2 10238796 missense probably damaging 1.00
R7597:Itih5 UTSW 2 10249376 missense probably damaging 1.00
R8025:Itih5 UTSW 2 10241022 missense probably benign 0.13
R8253:Itih5 UTSW 2 10238595 missense probably benign 0.06
R8349:Itih5 UTSW 2 10186989 missense probably benign 0.01
R8439:Itih5 UTSW 2 10235058 missense probably benign 0.19
R8449:Itih5 UTSW 2 10186989 missense probably benign 0.01
R8825:Itih5 UTSW 2 10190420 missense probably benign 0.00
X0026:Itih5 UTSW 2 10238559 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACCTCCGAATGGTCACAAG -3'
(R):5'- ATAGTGGCGAGAGGAGCTTC -3'

Sequencing Primer
(F):5'- TGGTCACAAGAAACAGCGC -3'
(R):5'- TTAGGAAACCCAATTCTACCCTCTGG -3'
Posted On2019-05-13