Incidental Mutation 'R7068:Ghsr'
ID548671
Institutional Source Beutler Lab
Gene Symbol Ghsr
Ensembl Gene ENSMUSG00000051136
Gene Namegrowth hormone secretagogue receptor
SynonymsC530020I22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7068 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location27371351-27378010 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 27371837 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 14 (V14D)
Ref Sequence ENSEMBL: ENSMUSP00000061153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057186]
Predicted Effect probably benign
Transcript: ENSMUST00000057186
AA Change: V14D

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000061153
Gene: ENSMUSG00000051136
AA Change: V14D

DomainStartEndE-ValueType
low complexity region 33 43 N/A INTRINSIC
Pfam:7TM_GPCR_Srw 47 339 5.8e-12 PFAM
Pfam:7TM_GPCR_Srsx 53 336 9.4e-8 PFAM
Pfam:7tm_1 59 321 7.9e-51 PFAM
Pfam:7TM_GPCR_Srv 61 338 4.8e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G-protein coupled receptor family. The encoded protein may play a role in energy homeostasis and regulation of body weight. Two identified transcript variants are expressed in several tissues and are evolutionary conserved in fish and swine. One transcript, 1a, excises an intron and encodes the functional protein; this protein is the receptor for the Ghrelin ligand and defines a neuroendocrine pathway for growth hormone release. The second transcript (1b) retains the intron and does not function as a receptor for Ghrelin; however, it may function to attenuate activity of isoform 1a. Mutations in this gene are associated with autosomal idiopathic short stature.[provided by RefSeq, Apr 2010]
PHENOTYPE: Homeostasis is disrupted by inactivation of this gene, namely growth hormone release and appetite stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 A G 7: 119,622,580 H24R probably benign Het
Ago2 A T 15: 73,146,450 F46L probably damaging Het
Amd1 A G 10: 40,290,512 F123L probably benign Het
Arhgef10 T C 8: 14,958,639 F546L probably damaging Het
Asic2 G A 11: 81,152,255 H71Y probably benign Het
Asphd1 A G 7: 126,948,678 V151A probably benign Het
Best3 T C 10: 116,988,638 V3A probably damaging Het
C4b A G 17: 34,733,477 L1196P probably damaging Het
Cd22 A G 7: 30,878,079 V3A probably benign Het
Cdkl3 T C 11: 52,011,327 probably null Het
Clcnka A T 4: 141,387,110 V631E probably damaging Het
Cmya5 A G 13: 93,092,697 V1961A possibly damaging Het
Dnah14 A G 1: 181,769,790 E3559G probably benign Het
Emsy A T 7: 98,610,761 D39E probably benign Het
Fam126a A G 5: 23,964,795 S519P possibly damaging Het
Fbxl16 G T 17: 25,819,511 V477F possibly damaging Het
Flt1 A T 5: 147,673,634 I393N probably damaging Het
Gabra4 A T 5: 71,572,059 N433K probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Glb1l A G 1: 75,202,737 Y183H probably damaging Het
Ighv3-4 T C 12: 114,253,654 T106A probably damaging Het
Ik T G 18: 36,755,465 F439V possibly damaging Het
Itih5 T C 2: 10,249,304 S789P probably damaging Het
Kcnj8 T C 6: 142,566,239 D214G probably damaging Het
Kdm5a C A 6: 120,430,215 H1464N probably benign Het
Klb A T 5: 65,379,340 Y671F probably damaging Het
Kremen2 C A 17: 23,741,885 R421L possibly damaging Het
Mroh9 T A 1: 163,039,181 D662V probably damaging Het
Mtmr12 T G 15: 12,257,670 M278R probably null Het
Ndufa8 T C 2: 36,044,435 M44V possibly damaging Het
Nedd4l A T 18: 65,205,651 R695S probably damaging Het
Nuf2 G A 1: 169,522,419 P97S probably damaging Het
Olfr1018 T C 2: 85,823,052 V27A probably benign Het
Olfr206 T C 16: 59,345,204 T166A possibly damaging Het
Olfr310 A C 7: 86,269,537 L84R probably damaging Het
P4ha2 A G 11: 54,110,994 T33A probably benign Het
Parp1 A G 1: 180,588,668 H544R probably damaging Het
Plec A G 15: 76,177,769 L2678P probably damaging Het
Rad1 T A 15: 10,490,293 Y85* probably null Het
Sema6d A G 2: 124,657,821 I309V probably benign Het
Skint2 T C 4: 112,624,351 V137A probably damaging Het
Slc23a3 T C 1: 75,133,233 N130S probably benign Het
Slc35f1 T C 10: 53,062,500 F176S probably damaging Het
Slc44a2 T A 9: 21,320,848 Y10N probably benign Het
Smarcc1 A G 9: 110,185,884 T506A probably damaging Het
Smchd1 A T 17: 71,387,092 S1219R probably benign Het
Smco1 A G 16: 32,274,111 N200S probably benign Het
Srcap A G 7: 127,541,943 T1571A probably benign Het
Strip2 C T 6: 29,932,208 T459I probably benign Het
Tarbp1 C T 8: 126,427,034 A1560T probably damaging Het
Tcl1b1 T A 12: 105,159,693 probably benign Het
Tdrd5 T C 1: 156,284,271 E436G probably damaging Het
Trim31 T A 17: 36,898,516 C55S probably damaging Het
Tsr1 G T 11: 74,903,919 E467* probably null Het
Tulp4 T A 17: 6,185,289 D178E probably damaging Het
Vmn1r30 A G 6: 58,435,010 V279A possibly damaging Het
Vmn2r98 A G 17: 19,065,313 R132G probably benign Het
Other mutations in Ghsr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Ghsr APN 3 27374873 missense possibly damaging 0.92
IGL00435:Ghsr APN 3 27372383 missense possibly damaging 0.91
IGL01376:Ghsr APN 3 27371828 missense probably benign
IGL02444:Ghsr APN 3 27372040 missense probably benign 0.17
IGL02650:Ghsr APN 3 27374855 missense probably benign 0.29
IGL02754:Ghsr APN 3 27372496 missense probably damaging 1.00
R0571:Ghsr UTSW 3 27372016 missense probably damaging 1.00
R0825:Ghsr UTSW 3 27374627 missense probably damaging 0.99
R1036:Ghsr UTSW 3 27374720 missense probably damaging 0.98
R1462:Ghsr UTSW 3 27371876 missense probably benign 0.01
R1462:Ghsr UTSW 3 27371876 missense probably benign 0.01
R1529:Ghsr UTSW 3 27372482 missense probably damaging 1.00
R1598:Ghsr UTSW 3 27372277 missense probably benign 0.27
R4846:Ghsr UTSW 3 27371837 missense probably benign
R4951:Ghsr UTSW 3 27372361 missense possibly damaging 0.83
R4993:Ghsr UTSW 3 27372254 missense possibly damaging 0.87
R5055:Ghsr UTSW 3 27372272 missense probably benign 0.28
R6843:Ghsr UTSW 3 27372527 missense probably benign
R6936:Ghsr UTSW 3 27372325 missense probably benign 0.02
R7318:Ghsr UTSW 3 27372467 missense possibly damaging 0.91
R7510:Ghsr UTSW 3 27372374 missense probably benign 0.05
R7889:Ghsr UTSW 3 27372166 missense probably benign 0.00
R7972:Ghsr UTSW 3 27372166 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCAGTGGGTCACTCTCTTC -3'
(R):5'- AGGCCATGCTGGATAGGTAG -3'

Sequencing Primer
(F):5'- ATCGCTAATGTTCGCACCC -3'
(R):5'- CCATGCTGGATAGGTAGAGGTTG -3'
Posted On2019-05-13