Incidental Mutation 'R7068:Gatad1'
ID548674
Institutional Source Beutler Lab
Gene Symbol Gatad1
Ensembl Gene ENSMUSG00000007415
Gene NameGATA zinc finger domain containing 1
Synonyms8430439A17Rik, B330017N08Rik, 2810047M21Rik, 9130430G15Rik, Odag, 2310031E19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.525) question?
Stock #R7068 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location3632932-3657185 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3643540 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 210 (R210G)
Ref Sequence ENSEMBL: ENSMUSP00000113271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007559] [ENSMUST00000119783] [ENSMUST00000140871] [ENSMUST00000196304]
Predicted Effect probably benign
Transcript: ENSMUST00000007559
SMART Domains Protein: ENSMUSP00000007559
Gene: ENSMUSG00000007415

DomainStartEndE-ValueType
SCOP:d1gnf__ 7 33 9e-5 SMART
low complexity region 34 83 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119783
AA Change: R210G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000113271
Gene: ENSMUSG00000007415
AA Change: R210G

DomainStartEndE-ValueType
Pfam:GATA 9 36 1.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140871
Predicted Effect probably benign
Transcript: ENSMUST00000196304
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a zinc finger at the N-terminus, and is thought to bind to a histone modification site that regulates gene expression. Mutations in this gene have been associated with autosomal recessive dilated cardiomyopathy. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 A G 7: 119,622,580 H24R probably benign Het
Ago2 A T 15: 73,146,450 F46L probably damaging Het
Amd1 A G 10: 40,290,512 F123L probably benign Het
Arhgef10 T C 8: 14,958,639 F546L probably damaging Het
Asic2 G A 11: 81,152,255 H71Y probably benign Het
Asphd1 A G 7: 126,948,678 V151A probably benign Het
Best3 T C 10: 116,988,638 V3A probably damaging Het
C4b A G 17: 34,733,477 L1196P probably damaging Het
Cd22 A G 7: 30,878,079 V3A probably benign Het
Cdkl3 T C 11: 52,011,327 probably null Het
Clcnka A T 4: 141,387,110 V631E probably damaging Het
Cmya5 A G 13: 93,092,697 V1961A possibly damaging Het
Dnah14 A G 1: 181,769,790 E3559G probably benign Het
Emsy A T 7: 98,610,761 D39E probably benign Het
Fam126a A G 5: 23,964,795 S519P possibly damaging Het
Fbxl16 G T 17: 25,819,511 V477F possibly damaging Het
Flt1 A T 5: 147,673,634 I393N probably damaging Het
Gabra4 A T 5: 71,572,059 N433K probably benign Het
Ghsr T A 3: 27,371,837 V14D probably benign Het
Glb1l A G 1: 75,202,737 Y183H probably damaging Het
Ighv3-4 T C 12: 114,253,654 T106A probably damaging Het
Ik T G 18: 36,755,465 F439V possibly damaging Het
Itih5 T C 2: 10,249,304 S789P probably damaging Het
Kcnj8 T C 6: 142,566,239 D214G probably damaging Het
Kdm5a C A 6: 120,430,215 H1464N probably benign Het
Klb A T 5: 65,379,340 Y671F probably damaging Het
Kremen2 C A 17: 23,741,885 R421L possibly damaging Het
Mroh9 T A 1: 163,039,181 D662V probably damaging Het
Mtmr12 T G 15: 12,257,670 M278R probably null Het
Ndufa8 T C 2: 36,044,435 M44V possibly damaging Het
Nedd4l A T 18: 65,205,651 R695S probably damaging Het
Nuf2 G A 1: 169,522,419 P97S probably damaging Het
Olfr1018 T C 2: 85,823,052 V27A probably benign Het
Olfr206 T C 16: 59,345,204 T166A possibly damaging Het
Olfr310 A C 7: 86,269,537 L84R probably damaging Het
P4ha2 A G 11: 54,110,994 T33A probably benign Het
Parp1 A G 1: 180,588,668 H544R probably damaging Het
Plec A G 15: 76,177,769 L2678P probably damaging Het
Rad1 T A 15: 10,490,293 Y85* probably null Het
Sema6d A G 2: 124,657,821 I309V probably benign Het
Skint2 T C 4: 112,624,351 V137A probably damaging Het
Slc23a3 T C 1: 75,133,233 N130S probably benign Het
Slc35f1 T C 10: 53,062,500 F176S probably damaging Het
Slc44a2 T A 9: 21,320,848 Y10N probably benign Het
Smarcc1 A G 9: 110,185,884 T506A probably damaging Het
Smchd1 A T 17: 71,387,092 S1219R probably benign Het
Smco1 A G 16: 32,274,111 N200S probably benign Het
Srcap A G 7: 127,541,943 T1571A probably benign Het
Strip2 C T 6: 29,932,208 T459I probably benign Het
Tarbp1 C T 8: 126,427,034 A1560T probably damaging Het
Tcl1b1 T A 12: 105,159,693 probably benign Het
Tdrd5 T C 1: 156,284,271 E436G probably damaging Het
Trim31 T A 17: 36,898,516 C55S probably damaging Het
Tsr1 G T 11: 74,903,919 E467* probably null Het
Tulp4 T A 17: 6,185,289 D178E probably damaging Het
Vmn1r30 A G 6: 58,435,010 V279A possibly damaging Het
Vmn2r98 A G 17: 19,065,313 R132G probably benign Het
Other mutations in Gatad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1183:Gatad1 UTSW 5 3643707 missense possibly damaging 0.95
R1189:Gatad1 UTSW 5 3643701 missense probably damaging 1.00
R1501:Gatad1 UTSW 5 3643701 missense probably damaging 1.00
R3120:Gatad1 UTSW 5 3641456 nonsense probably null
R4463:Gatad1 UTSW 5 3647404 missense probably benign 0.05
R6973:Gatad1 UTSW 5 3643540 missense probably benign 0.03
R6974:Gatad1 UTSW 5 3643540 missense probably benign 0.03
R6975:Gatad1 UTSW 5 3643540 missense probably benign 0.03
R7071:Gatad1 UTSW 5 3643540 missense probably benign 0.03
R7673:Gatad1 UTSW 5 3646867 missense probably benign 0.06
R7948:Gatad1 UTSW 5 3643540 missense probably benign 0.03
R8013:Gatad1 UTSW 5 3643540 missense probably benign 0.03
R8028:Gatad1 UTSW 5 3643540 missense probably benign 0.03
R8033:Gatad1 UTSW 5 3643540 missense probably benign 0.03
R8036:Gatad1 UTSW 5 3643540 missense probably benign 0.03
R8068:Gatad1 UTSW 5 3643540 missense probably benign 0.03
R8069:Gatad1 UTSW 5 3643540 missense probably benign 0.03
R8070:Gatad1 UTSW 5 3643540 missense probably benign 0.03
R8127:Gatad1 UTSW 5 3643540 missense probably benign 0.03
R8963:Gatad1 UTSW 5 3641544 missense probably damaging 1.00
RF015:Gatad1 UTSW 5 3647523 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CCATTAGGCAGGTAATCATGGTC -3'
(R):5'- TTTCTGTGATTGATGAGCAAGATG -3'

Sequencing Primer
(F):5'- CCCTAAATGGTGAGACTGGTGTCC -3'
(R):5'- ATGGGAAGCCGTACTATGCTC -3'
Posted On2019-05-13