Incidental Mutation 'R7068:Gabra4'
ID548677
Institutional Source Beutler Lab
Gene Symbol Gabra4
Ensembl Gene ENSMUSG00000029211
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit alpha 4
SynonymsGabra-4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7068 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location71569749-71658308 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71572059 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 433 (N433K)
Ref Sequence ENSEMBL: ENSMUSP00000031121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031121] [ENSMUST00000197994] [ENSMUST00000198138] [ENSMUST00000199357]
Predicted Effect probably benign
Transcript: ENSMUST00000031121
AA Change: N433K

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000031121
Gene: ENSMUSG00000029211
AA Change: N433K

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Neur_chan_LBD 48 256 8.8e-52 PFAM
Pfam:Neur_chan_memb 263 536 3.4e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197994
Predicted Effect probably benign
Transcript: ENSMUST00000198138
SMART Domains Protein: ENSMUSP00000142466
Gene: ENSMUSG00000029211

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
SCOP:d1i9ba_ 53 69 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199357
AA Change: N459K

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000143675
Gene: ENSMUSG00000029211
AA Change: N459K

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Neur_chan_LBD 91 282 1.7e-45 PFAM
Pfam:Neur_chan_memb 289 562 3.3e-44 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Gamma-aminobutyric acid (GABA) is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. At least 16 distinct subunits of GABA-A receptors have been identified. This gene encodes subunit alpha-4, which is involved in the etiology of autism and eventually increases autism risk through interaction with another subunit, gamma-aminobutyric acid receptor beta-1 (GABRB1). Alternatively spliced transcript variants encoding different isoforms have been found in this gene.[provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous mutation of this gene does not appear to result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 A G 7: 119,622,580 H24R probably benign Het
Ago2 A T 15: 73,146,450 F46L probably damaging Het
Amd1 A G 10: 40,290,512 F123L probably benign Het
Arhgef10 T C 8: 14,958,639 F546L probably damaging Het
Asic2 G A 11: 81,152,255 H71Y probably benign Het
Asphd1 A G 7: 126,948,678 V151A probably benign Het
Best3 T C 10: 116,988,638 V3A probably damaging Het
C4b A G 17: 34,733,477 L1196P probably damaging Het
Cd22 A G 7: 30,878,079 V3A probably benign Het
Cdkl3 T C 11: 52,011,327 probably null Het
Clcnka A T 4: 141,387,110 V631E probably damaging Het
Cmya5 A G 13: 93,092,697 V1961A possibly damaging Het
Dnah14 A G 1: 181,769,790 E3559G probably benign Het
Emsy A T 7: 98,610,761 D39E probably benign Het
Fam126a A G 5: 23,964,795 S519P possibly damaging Het
Fbxl16 G T 17: 25,819,511 V477F possibly damaging Het
Flt1 A T 5: 147,673,634 I393N probably damaging Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Ghsr T A 3: 27,371,837 V14D probably benign Het
Glb1l A G 1: 75,202,737 Y183H probably damaging Het
Ighv3-4 T C 12: 114,253,654 T106A probably damaging Het
Ik T G 18: 36,755,465 F439V possibly damaging Het
Itih5 T C 2: 10,249,304 S789P probably damaging Het
Kcnj8 T C 6: 142,566,239 D214G probably damaging Het
Kdm5a C A 6: 120,430,215 H1464N probably benign Het
Klb A T 5: 65,379,340 Y671F probably damaging Het
Kremen2 C A 17: 23,741,885 R421L possibly damaging Het
Mroh9 T A 1: 163,039,181 D662V probably damaging Het
Mtmr12 T G 15: 12,257,670 M278R probably null Het
Ndufa8 T C 2: 36,044,435 M44V possibly damaging Het
Nedd4l A T 18: 65,205,651 R695S probably damaging Het
Nuf2 G A 1: 169,522,419 P97S probably damaging Het
Olfr1018 T C 2: 85,823,052 V27A probably benign Het
Olfr206 T C 16: 59,345,204 T166A possibly damaging Het
Olfr310 A C 7: 86,269,537 L84R probably damaging Het
P4ha2 A G 11: 54,110,994 T33A probably benign Het
Parp1 A G 1: 180,588,668 H544R probably damaging Het
Plec A G 15: 76,177,769 L2678P probably damaging Het
Rad1 T A 15: 10,490,293 Y85* probably null Het
Sema6d A G 2: 124,657,821 I309V probably benign Het
Skint2 T C 4: 112,624,351 V137A probably damaging Het
Slc23a3 T C 1: 75,133,233 N130S probably benign Het
Slc35f1 T C 10: 53,062,500 F176S probably damaging Het
Slc44a2 T A 9: 21,320,848 Y10N probably benign Het
Smarcc1 A G 9: 110,185,884 T506A probably damaging Het
Smchd1 A T 17: 71,387,092 S1219R probably benign Het
Smco1 A G 16: 32,274,111 N200S probably benign Het
Srcap A G 7: 127,541,943 T1571A probably benign Het
Strip2 C T 6: 29,932,208 T459I probably benign Het
Tarbp1 C T 8: 126,427,034 A1560T probably damaging Het
Tcl1b1 T A 12: 105,159,693 probably benign Het
Tdrd5 T C 1: 156,284,271 E436G probably damaging Het
Trim31 T A 17: 36,898,516 C55S probably damaging Het
Tsr1 G T 11: 74,903,919 E467* probably null Het
Tulp4 T A 17: 6,185,289 D178E probably damaging Het
Vmn1r30 A G 6: 58,435,010 V279A possibly damaging Het
Vmn2r98 A G 17: 19,065,313 R132G probably benign Het
Other mutations in Gabra4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:Gabra4 APN 5 71633629 missense probably damaging 1.00
IGL01503:Gabra4 APN 5 71641086 missense possibly damaging 0.60
IGL02028:Gabra4 APN 5 71633596 missense probably damaging 1.00
IGL02688:Gabra4 APN 5 71572167 missense probably benign
IGL02749:Gabra4 APN 5 71638147 missense probably benign 0.42
IGL03095:Gabra4 APN 5 71624015 missense probably damaging 1.00
IGL03330:Gabra4 APN 5 71641064 missense probably null 1.00
E0354:Gabra4 UTSW 5 71640861 missense probably damaging 1.00
PIT4142001:Gabra4 UTSW 5 71571763 missense probably damaging 1.00
R1523:Gabra4 UTSW 5 71633632 missense probably damaging 1.00
R1622:Gabra4 UTSW 5 71571986 missense possibly damaging 0.57
R1689:Gabra4 UTSW 5 71633542 splice site probably null
R1930:Gabra4 UTSW 5 71638237 missense probably damaging 1.00
R1931:Gabra4 UTSW 5 71638237 missense probably damaging 1.00
R1967:Gabra4 UTSW 5 71572069 missense possibly damaging 0.87
R2095:Gabra4 UTSW 5 71624112 missense probably damaging 0.99
R2131:Gabra4 UTSW 5 71641224 missense probably benign 0.00
R2698:Gabra4 UTSW 5 71572078 missense probably benign 0.03
R3884:Gabra4 UTSW 5 71657257 missense probably benign 0.33
R3924:Gabra4 UTSW 5 71642253 splice site probably benign
R4029:Gabra4 UTSW 5 71572189 missense probably benign 0.31
R4361:Gabra4 UTSW 5 71633545 critical splice donor site probably null
R4659:Gabra4 UTSW 5 71641144 missense probably damaging 1.00
R4682:Gabra4 UTSW 5 71657809 start codon destroyed probably null 0.74
R4810:Gabra4 UTSW 5 71623982 missense probably damaging 1.00
R4888:Gabra4 UTSW 5 71572203 missense probably benign 0.01
R5093:Gabra4 UTSW 5 71640864 missense probably damaging 1.00
R5121:Gabra4 UTSW 5 71572203 missense probably benign 0.01
R5889:Gabra4 UTSW 5 71571891 missense possibly damaging 0.61
R5906:Gabra4 UTSW 5 71623910 missense probably benign 0.00
R6574:Gabra4 UTSW 5 71623925 missense probably benign
R7571:Gabra4 UTSW 5 71571992 missense probably benign
R7815:Gabra4 UTSW 5 71657809 start codon destroyed possibly damaging 0.54
R7817:Gabra4 UTSW 5 71640863 missense probably damaging 1.00
R7840:Gabra4 UTSW 5 71640913 splice site probably null
R7899:Gabra4 UTSW 5 71657995 unclassified probably benign
R8000:Gabra4 UTSW 5 71623961 missense probably damaging 1.00
R8057:Gabra4 UTSW 5 71623952 missense probably benign 0.12
R8996:Gabra4 UTSW 5 71571703 missense possibly damaging 0.51
Z1176:Gabra4 UTSW 5 71623895 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- GCAGCCCCTGTTGTATTAACTG -3'
(R):5'- GGTTATTTTATAGACCCGAGTAATCAC -3'

Sequencing Primer
(F):5'- AACTGTTGTCTTAATTCGCCCAAG -3'
(R):5'- GGTCCATTCAGAATCGGAT -3'
Posted On2019-05-13