Incidental Mutation 'R7068:Cdkl3'
ID548696
Institutional Source Beutler Lab
Gene Symbol Cdkl3
Ensembl Gene ENSMUSG00000020389
Gene Namecyclin-dependent kinase-like 3
SynonymsB230379H01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.799) question?
Stock #R7068 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location52004221-52089784 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 52011327 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063303] [ENSMUST00000063303] [ENSMUST00000063321] [ENSMUST00000063321] [ENSMUST00000109076] [ENSMUST00000109076] [ENSMUST00000109077] [ENSMUST00000109077] [ENSMUST00000109078] [ENSMUST00000109078] [ENSMUST00000109079] [ENSMUST00000109079] [ENSMUST00000109080] [ENSMUST00000109080] [ENSMUST00000109081] [ENSMUST00000109081] [ENSMUST00000120374] [ENSMUST00000120374] [ENSMUST00000121591] [ENSMUST00000121591] [ENSMUST00000135076] [ENSMUST00000135076] [ENSMUST00000143228]
Predicted Effect probably null
Transcript: ENSMUST00000063303
SMART Domains Protein: ENSMUSP00000064315
Gene: ENSMUSG00000020389

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 1e-18 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000063303
SMART Domains Protein: ENSMUSP00000064315
Gene: ENSMUSG00000020389

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 1e-18 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000063321
SMART Domains Protein: ENSMUSP00000065128
Gene: ENSMUSG00000020389

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 9e-19 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000063321
SMART Domains Protein: ENSMUSP00000065128
Gene: ENSMUSG00000020389

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 9e-19 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000109076
SMART Domains Protein: ENSMUSP00000104704
Gene: ENSMUSG00000020389

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109076
SMART Domains Protein: ENSMUSP00000104704
Gene: ENSMUSG00000020389

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109077
SMART Domains Protein: ENSMUSP00000104705
Gene: ENSMUSG00000020389

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109077
SMART Domains Protein: ENSMUSP00000104705
Gene: ENSMUSG00000020389

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109078
SMART Domains Protein: ENSMUSP00000104706
Gene: ENSMUSG00000020389

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 457 8e-14 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000109078
SMART Domains Protein: ENSMUSP00000104706
Gene: ENSMUSG00000020389

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 457 8e-14 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000109079
SMART Domains Protein: ENSMUSP00000104707
Gene: ENSMUSG00000020389

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 9e-19 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000109079
SMART Domains Protein: ENSMUSP00000104707
Gene: ENSMUSG00000020389

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 9e-19 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000109080
SMART Domains Protein: ENSMUSP00000104708
Gene: ENSMUSG00000020389

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 1e-18 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000109080
SMART Domains Protein: ENSMUSP00000104708
Gene: ENSMUSG00000020389

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 1e-18 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000109081
SMART Domains Protein: ENSMUSP00000104709
Gene: ENSMUSG00000020389

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 1e-18 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000109081
SMART Domains Protein: ENSMUSP00000104709
Gene: ENSMUSG00000020389

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 1e-18 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000120374
SMART Domains Protein: ENSMUSP00000113303
Gene: ENSMUSG00000020389

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 1e-18 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000120374
SMART Domains Protein: ENSMUSP00000113303
Gene: ENSMUSG00000020389

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 1e-18 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000121591
SMART Domains Protein: ENSMUSP00000112477
Gene: ENSMUSG00000020389

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 1e-18 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000121591
SMART Domains Protein: ENSMUSP00000112477
Gene: ENSMUSG00000020389

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 1e-18 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000135076
SMART Domains Protein: ENSMUSP00000117983
Gene: ENSMUSG00000020389

DomainStartEndE-ValueType
Pfam:Pkinase 4 192 5.6e-65 PFAM
Pfam:Pkinase_Tyr 4 192 7.3e-37 PFAM
Pfam:Kinase-like 49 192 3.2e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000135076
SMART Domains Protein: ENSMUSP00000117983
Gene: ENSMUSG00000020389

DomainStartEndE-ValueType
Pfam:Pkinase 4 192 5.6e-65 PFAM
Pfam:Pkinase_Tyr 4 192 7.3e-37 PFAM
Pfam:Kinase-like 49 192 3.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143228
SMART Domains Protein: ENSMUSP00000123279
Gene: ENSMUSG00000020389

DomainStartEndE-ValueType
S_TKc 4 286 2.27e-95 SMART
Blast:S_TKc 361 477 1e-18 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of cyclin-dependent protein kinase (CDK) family. CDK family members are highly similar to the gene products of Saccharomyces cerevisiae cdc28, and Schizosaccharomyces pombe cdc2, and are known to be important regulators of cell cycle progression. This gene was identified as a gene absent in leukemic patients with chromosome 5q deletion. This loss may be an important determinant of dysmyelopoiesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 A G 7: 119,622,580 H24R probably benign Het
Ago2 A T 15: 73,146,450 F46L probably damaging Het
Amd1 A G 10: 40,290,512 F123L probably benign Het
Arhgef10 T C 8: 14,958,639 F546L probably damaging Het
Asic2 G A 11: 81,152,255 H71Y probably benign Het
Asphd1 A G 7: 126,948,678 V151A probably benign Het
Best3 T C 10: 116,988,638 V3A probably damaging Het
C4b A G 17: 34,733,477 L1196P probably damaging Het
Cd22 A G 7: 30,878,079 V3A probably benign Het
Clcnka A T 4: 141,387,110 V631E probably damaging Het
Cmya5 A G 13: 93,092,697 V1961A possibly damaging Het
Dnah14 A G 1: 181,769,790 E3559G probably benign Het
Emsy A T 7: 98,610,761 D39E probably benign Het
Fam126a A G 5: 23,964,795 S519P possibly damaging Het
Fbxl16 G T 17: 25,819,511 V477F possibly damaging Het
Flt1 A T 5: 147,673,634 I393N probably damaging Het
Gabra4 A T 5: 71,572,059 N433K probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Ghsr T A 3: 27,371,837 V14D probably benign Het
Glb1l A G 1: 75,202,737 Y183H probably damaging Het
Ighv3-4 T C 12: 114,253,654 T106A probably damaging Het
Ik T G 18: 36,755,465 F439V possibly damaging Het
Itih5 T C 2: 10,249,304 S789P probably damaging Het
Kcnj8 T C 6: 142,566,239 D214G probably damaging Het
Kdm5a C A 6: 120,430,215 H1464N probably benign Het
Klb A T 5: 65,379,340 Y671F probably damaging Het
Kremen2 C A 17: 23,741,885 R421L possibly damaging Het
Mroh9 T A 1: 163,039,181 D662V probably damaging Het
Mtmr12 T G 15: 12,257,670 M278R probably null Het
Ndufa8 T C 2: 36,044,435 M44V possibly damaging Het
Nedd4l A T 18: 65,205,651 R695S probably damaging Het
Nuf2 G A 1: 169,522,419 P97S probably damaging Het
Olfr1018 T C 2: 85,823,052 V27A probably benign Het
Olfr206 T C 16: 59,345,204 T166A possibly damaging Het
Olfr310 A C 7: 86,269,537 L84R probably damaging Het
P4ha2 A G 11: 54,110,994 T33A probably benign Het
Parp1 A G 1: 180,588,668 H544R probably damaging Het
Plec A G 15: 76,177,769 L2678P probably damaging Het
Rad1 T A 15: 10,490,293 Y85* probably null Het
Sema6d A G 2: 124,657,821 I309V probably benign Het
Skint2 T C 4: 112,624,351 V137A probably damaging Het
Slc23a3 T C 1: 75,133,233 N130S probably benign Het
Slc35f1 T C 10: 53,062,500 F176S probably damaging Het
Slc44a2 T A 9: 21,320,848 Y10N probably benign Het
Smarcc1 A G 9: 110,185,884 T506A probably damaging Het
Smchd1 A T 17: 71,387,092 S1219R probably benign Het
Smco1 A G 16: 32,274,111 N200S probably benign Het
Srcap A G 7: 127,541,943 T1571A probably benign Het
Strip2 C T 6: 29,932,208 T459I probably benign Het
Tarbp1 C T 8: 126,427,034 A1560T probably damaging Het
Tcl1b1 T A 12: 105,159,693 probably benign Het
Tdrd5 T C 1: 156,284,271 E436G probably damaging Het
Trim31 T A 17: 36,898,516 C55S probably damaging Het
Tsr1 G T 11: 74,903,919 E467* probably null Het
Tulp4 T A 17: 6,185,289 D178E probably damaging Het
Vmn1r30 A G 6: 58,435,010 V279A possibly damaging Het
Vmn2r98 A G 17: 19,065,313 R132G probably benign Het
Other mutations in Cdkl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Cdkl3 APN 11 52029856 missense probably benign 0.28
IGL01632:Cdkl3 APN 11 52005072 missense probably damaging 1.00
IGL01768:Cdkl3 APN 11 52025917 missense probably damaging 1.00
IGL01974:Cdkl3 APN 11 52011237 missense probably damaging 1.00
IGL01981:Cdkl3 APN 11 52005069 missense probably benign 0.43
IGL02510:Cdkl3 APN 11 52011270 missense probably damaging 1.00
R0027:Cdkl3 UTSW 11 52032349 unclassified probably benign
R0027:Cdkl3 UTSW 11 52032349 unclassified probably benign
R0480:Cdkl3 UTSW 11 52005055 missense probably damaging 1.00
R0499:Cdkl3 UTSW 11 52032416 missense possibly damaging 0.52
R0627:Cdkl3 UTSW 11 52011308 missense probably damaging 1.00
R0848:Cdkl3 UTSW 11 52011267 missense probably damaging 1.00
R1510:Cdkl3 UTSW 11 52033514 missense possibly damaging 0.90
R1558:Cdkl3 UTSW 11 52032510 missense possibly damaging 0.62
R2046:Cdkl3 UTSW 11 52026850 missense probably benign
R2077:Cdkl3 UTSW 11 52026839 missense probably damaging 0.98
R2207:Cdkl3 UTSW 11 52027193 makesense probably null
R2271:Cdkl3 UTSW 11 52032495 missense probably benign 0.07
R2272:Cdkl3 UTSW 11 52032495 missense probably benign 0.07
R4032:Cdkl3 UTSW 11 52011291 missense probably damaging 1.00
R4839:Cdkl3 UTSW 11 52005034 missense probably damaging 1.00
R4971:Cdkl3 UTSW 11 52011168 missense possibly damaging 0.48
R6541:Cdkl3 UTSW 11 52022744 missense probably damaging 1.00
R6559:Cdkl3 UTSW 11 52025869 missense probably benign 0.04
R7034:Cdkl3 UTSW 11 52027215 missense probably benign 0.00
R7406:Cdkl3 UTSW 11 52033542 missense probably benign 0.11
R7658:Cdkl3 UTSW 11 52027182 missense not run
R7870:Cdkl3 UTSW 11 52018457 critical splice donor site probably null
R8324:Cdkl3 UTSW 11 52022879 critical splice donor site probably null
R8331:Cdkl3 UTSW 11 52026877 missense probably benign 0.04
R8349:Cdkl3 UTSW 11 52084433 missense
R8449:Cdkl3 UTSW 11 52084433 missense
Predicted Primers PCR Primer
(F):5'- GGCATGAAAACCTGGTCAATTTG -3'
(R):5'- TCTCAGTATTCTGGTCACAGC -3'

Sequencing Primer
(F):5'- TCTTAGATGAGCTGCAGC -3'
(R):5'- AGTATTCTGGTCACAGCTCATG -3'
Posted On2019-05-13